Labshake search
Citations for Roche :
2351 - 2400 of 8781 citations for 6H Imidazo 4 5 e 2 1 3 benzothiadiazole 7 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were prepared using 5 μL of FastStart SYBR Green Master mix (Roche Diagnostics) with a final concentration of 1μM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... membranes were blocked in 5% BSA (BSA Fraction V; Roche Life Sciences, Almere, The Netherlands) in TBS-T or 5% milk in TBS-T for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Molecular Biology 2019Quote: ... 1.5 μl DNA Pol Mix (5 U/μl, Expand Long Template PCR System, Roche Diagnostics), 27.25 μl PCR HPLC Gradient Grade H2O and 1 μl template (primary WTA product) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 2ME [pH 7.5]) supplemented with protease and phosphatase inhibitors (Roche, Indianapolis, IN) for 20 minutes on ice ...
-
bioRxiv - Cell Biology 2019Quote: ... ATP 5 mM) supplemented with proteases and phosphatase inhibitors (cOmplete EDTA-free and PhosSTOP, Roche). Cells were homogenized in a ball homogenizer with 10 μm clearance ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... A 5% Triton X-100 solution with 1x protease inhibitors (Roche Complete Mini, EDTA free) was added 1:1 to a 50 μl worm pellet ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA pH 8.0) supplemented with protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche, 11697498001) and lysed by vortexing at 4 °C for 15 minutes.™ Cell debris was pelleted by spinning at 21000 RCF at 4 °C for 15 minutes and protein containing supernatant was taken ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5×106 K562 cells were resuspended in PBS with EDTA-free protease inhibitor cocktail (Roche) and lysed using a 27.5G needle ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM MgCl2 and 0.25 M sucrose) supplemented with a protease inhibitor cocktail tablet (Roche). Successively ...
-
bioRxiv - Physiology 2023Quote: ... Worms were homogenized in PBS containing 5% TritonX-100 and a protease inhibitor cocktail (Roche), and lipid was extracted using the TissueLyser II (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...
-
bioRxiv - Genetics 2024Quote: ... snRNA-seq 5’ libraries were balanced using a Kapa library quantification kit (Roche, Indianapolis, IN) and pooled to generate 150 base pair ...
-
bioRxiv - Neuroscience 2024Quote: Adenosine 5’-triphosphate (ATP) levels were assessed using an ATP Bioluminescence assay Kit (Sigma/Roche). Briefly ...
-
bioRxiv - Biophysics 2024Quote: ... 5% (v/v) Glycerol and EDTA-free protease inhibitor cocktail tablet/50 ml (Roche, UK)] ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL PCR grade water and 12.5 µL KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, USA). Samples were normalized and pooled in equimolar amounts and the pools were sequenced on the Illumina MiSeq machine with the 2 x 300 bp V3 kit at the USEQ sequencing facility (Utrecht University ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL PCR grade water and 12.5 µL KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, USA). The PCR conditions were 98°C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... A 2-step qPCR was done using the LightCycler 480 (Roche, Anderlecht, Belgium). The activation cycle was at 95 °C for 10 minutes ...
-
bioRxiv - Genomics 2019Quote: ... 5.6mmol/L glucose with 2% BSA fraction V fatty acid free (Roche Diagnostics), 50μmol/L 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2019Quote: ... The enzymatic mix was composed by 2 μg/ml collagenase A (Roche 10103586001), 2,4 U/ml dispase II (Roche 04942078001 ...
-
bioRxiv - Microbiology 2019Quote: ... Reactions were performed in 1X FastStart Universal Probe Master Mix (Rox) 2× (Roche) in 20 µl volume ...
-
bioRxiv - Bioengineering 2020Quote: ... and 10 μl of 2× KAPA HiFi HotStart Ready Mix (KAPA Biosystems, USA). The following conditions were used ...
-
bioRxiv - Genomics 2021Quote: ... ChIP enrichments were confirmed by qPCR with 2× SYBR FAST mastermix (KAPA Biosystems) using the CFX384 Real-Time System C1000 Touch Thermo Cycler (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM TCEP and an EDTA-free protease inhibitor cocktail tablet (cOmplete, Roche)) and lysed by sonication ...
-
bioRxiv - Immunology 2021Quote: ... and 2 μl of 10 mg/ml of DNase (Roche, catalog no. 10104159001) in an Eppendorf tube ...
-
bioRxiv - Neuroscience 2020Quote: ... Pellet was enzymatically digested in collagenase/liberase TL (2 U/mL) (Roche Diagnostics) for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR reaction was performed on a Light Cycler 2 (Roche) using 10 μL SYBR Premix Ex Taq (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol) and supplemented with complete EDTA-free cocktail tablets (Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 0.1 mM TCEP (Tris(2-carboxyethyl)phosphine) supplemented with cOmplete protease inhibitors (Roche). Clarified lysates were passed over 5 ml of packed Ni-NTA agarose resin (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1% 2-Mercaptoethanol) with freshly added protease inhibitor and phosphatase inhibitor cocktail (Roche). Protein equivalent to 10μg was estimated by Bradford assay.
-
bioRxiv - Neuroscience 2022Quote: ... followed by a 2 h incubation with Protein A Agarose beads (Roche, 11719408001) at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl of 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, Washington, USA), 1.4 μl of each primer (2.5 μM) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM EDTA) supplemented with EDTA-free cOmplete Protease Inhibitor Cocktail tablet (Roche) and immunoprecipitated using C9-agarose bead (Cube biotech ...
-
bioRxiv - Molecular Biology 2022Quote: ... SARS-CoV-2 ORFs were amplified by PCR (KAPA HiFi HotStart ReadyMix, Roche) from the 2xStrep-tagged or 3xFLAG-tagged plasmids with oligonucleotide primers containing attB recombination sites and recombined into pDONR221 using BP clonase II (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellet was resuspended in 2 mL Red blood cell lysis buffer (Roche) with 5 µL DNAse (1 mg/mL) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 200 U/ml of recombinant human IL-2 (Roche, Nutley NJ, USA). All cell lines were grown in cell culture incubators at 37°C in the presence of 5% CO2.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM DTT and supplemented with Complete EDTA-free protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2× ReadyMix (Kapa Biosystems) for 21 cycles ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA (2 µg) was treated with 10 units of DNase I (Roche) for 30 min at 37°C and then for 15 min at 70°C ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 μg of total RNA and Transcriptor High Fidelity cDNA Synthesis kit (Roche). Transcript abundance was assayed by semi-quantitative PCR for two gene regions – up-stream and down-stream from the CRISPR-generated insertion (see Supplemental Fig ...