Labshake search
Citations for Roche :
2201 - 2250 of 2543 citations for Mouse Anti Chikungunya Virus VLP AG7 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes produced as described above were detected using alkaline-phosphatase-conjugated anti-digoxigenin Fab fragments (1:2000, [Roche]). Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1010 ...
-
bioRxiv - Plant Biology 2023Quote: ... membranes were cut and immunodetected with either Horse Radish Peroxidase (HRP)-conjugated 3F10 anti-HA (1:2000, Roche) or HRP-conjugated Flag M2 (1:2000 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mM b-mercaptoethanol (BME)] in the presence of an anti-protease cocktail (Complete EDTA-free, Roche) and 1 μl of benzonase (Merck Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: The following antibodies were used for immunoblots and immunoprecipitations: anti-HA as purified antibody or matrix (3F10, Roche), anti-FLAG as purified antibody or matrix (M2 ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Biochemistry 2024Quote: ... HA- and GFP-tagged proteins were detected using horseradish peroxidase-conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Molecular Biology 2024Quote: Western blots were carried out as described previously (Díaz-López et al., 2019) using the following primary antibodies: anti-EGFP (11814460001, Roche), anti-dsRed (a gift from José María Requena ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were incubated in primary antibody diluted in blocking buffer [rat anti-HA HRP 1:500 (Roche 12013819001), mouse anti-tubulin 1:1000 (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-sense RNA probes were transcribed from the DNA template using digoxigenin (DIG)-11-UTP Labelling Mix (Roche, UK), cleaned using spin filters (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were subsequently blocked in 1% fish-skin gelatin in PBS and grids were incubated in a 1:50 dilution of anti-GFP antibody (AB_390913, Roche) and labeled with 10 nm Protein A-gold particles (Utrecht Medical Center) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS and 50 mM DTT with the addition of anti-protease (cOmplete cocktail, Roche 11 873 588 001). Samples were boiled 5 min at 95°C before loading on polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2021Quote: ... Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000; Roche). Primers used for generating PCR templates are listed in Key Resources Table.
-
bioRxiv - Genetics 2021Quote: ... Cell lysates were cleared by centrifugation at 13 000 g for 30 min and supernatants were incubated for 30 min with 2.5 μg/sample anti-HA antibodies (clone 3F10, Roche) bound to 50 μL/sample (or 1.5 mg/sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Developmental Biology 2020Quote: ... they were hybridized overnight at 65°C for three nights and incubated overnight with 1/2,000 alkaline-phosphatase conjugated with anti-DIG Fab fragment (Roche) at 4°C for three nights ...
-
bioRxiv - Developmental Biology 2021Quote: ... blocked in 1xBM Blocking/PBST at RT for 2 hours and incubated with anti-DIG-POD (1:1,000, 11207733910, Roche) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: In situ antibody stainings were done as described previously 31 using rat anti-HA (MAb 3F10, 1:20; Roche), rabbit anti-FLAG (M2 ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was incubated with horseradish peroxidase (HRP)-conjugated rat anti-HA (clone 3F10) monoclonal antibodies (Roche, Indianapolis, IN) at a dilution of 1:5,000 for 2 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Beads were removed by centrifugation (twice at 1,000 xg) and then pre-cleared lysates were supplemented with anti-HA high affinity monoclonal antibody (clone 3F10, Roche) at 2 µg/ml final concentration along with 20 µl Protein G Sepharose beads and incubated at 4° C for 4 hours on a rotating wheel ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatant was separated from lysates by centrifugation at 20,000×g for 10 minutes and used for immunoprecipitation using 20 µg of anti-GFP antibody (11814460001, Roche) (used for GFP-CENP-ACnp1 and Hap2-GFP IP ...
-
bioRxiv - Cell Biology 2019Quote: ... silanized slides and coverslips were assembled into chambers using double-sided tape and functionalized with anti-DIG IgG (Roche), then passivated with 1% Tween-20 ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were boiled 5 min and 50 μg of proteins were separated by electrophoresis on 12.5% SDS-PAGE and subjected to immunoanalysis with either anti-GFP antibody (Roche), anti-Pgk1 antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... the proteins were blotted onto a nitrocellulose membrane and probed with anti-GFP (1:1000; Sigma-Aldrich and Roche), anti-dgt6 (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... The signals were visualized with a nonradioactive detection system using anti-digoxigenin Fab fragment conjugated to alkaline phosphatase (Roche).
-
bioRxiv - Cancer Biology 2021Quote: GSDMB2-HA expression was analyzed by immunohistochemistry in 5µm-thick tissue sections using rat anti-HA (1:200; 3F10, ROCHE) or mouse monoclonal anti-GSDMB (1:10 ...
-
bioRxiv - Cell Biology 2021Quote: ... and thiamine-dependent repression was validated by immuno blotting of whole cell extracts using anti-HA antibodies (Roche, 3F10).
-
bioRxiv - Developmental Biology 2021Quote: ... 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910; 1:2,500 dilution) at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated with an anti-DIG antibody conjugated with horse radish peroxidase (HRP) (1/500, Roche Diagnostics) for 6 hours at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: Antibodies used for western blots presented in this work were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:2,000) (Roche); mouse anti-GAPDH mAb (1:20,000) ...
-
bioRxiv - Microbiology 2022Quote: ... The membranes were then blocked for an hour in 5% milk powder/PBS solution and probed with 1:2,500 rat anti-HA mAb 3F10 antibody (Roche) in 5% milk powder/PBS solution overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... In situ hybridization signals in whole-mount embryos were detected using anti-DIG alkaline phosphatase (AP)-conjugated antibody (Roche) with an AP substrate ...
-
bioRxiv - Developmental Biology 2021Quote: ... The mRNA expression patterns were visualized by immunoreactivity with anti-digoxigenin horseradish peroxidase-conjugated Fab-fragments (Roche, Basel, Switzerland), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
bioRxiv - Neuroscience 2021Quote: ... ISH detection was performed using anti-DIG secondary antibody conjugated with radish peroxidase (POD) (Roche Diagnostics Corp., Indianapolis, IN) and Opal 570 (1:500 ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... The slides were incubated overnight with a 1:5,000 dilution of alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics). After the slides had been washed in in a solution of 0.1 M Tris (pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then washed in KPBS and incubated with rabbit anti-FG antibody (1:5000; Chemicon International, Calif, USA) in 0.5% Blocking Reagent (Roche) in KPBS for 16 h at 4 ° C ...
-
bioRxiv - Neuroscience 2022Quote: ... Digoxigenin probes were made by standard protocols and were detected using the anti-DIG POD antibody (Roche, 1:1000) and stained using Cy3-tyramide substrate (Perkin Elmer ...
-
bioRxiv - Cell Biology 2019Quote: ... and rat monoclonal anti-HA High Affinity for 60 minutes at room temperature (clone 3F10; 1:50 dilution, Roche). The sections were rinsed in PBS before incubation for 30 minutes with secondary Immunotech biotinylated antibody and 45 minutes with the Streptavidine-Peroxidase Complex (universal HRP immunostaining ...