Labshake search
Citations for Roche :
2201 - 2250 of 3367 citations for 6 hydroxy 4 6 dihydrofuro 3 2 c pyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Cell Biology 2024Quote: ... a final concentration of 1 ng/μl cDNA was mixed with 2 μl FastStart DNA Master SYBR Green I (Roche #03 003 230 001), 0.5 μM forward and reverse primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Genetics 2024Quote: ... 30 mM Tris-HCl, 20 mM KCl, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 150 mM NaCl, cOmplete proteinase inhibitor [Roche Diagnostics, Indianapolis, IN, USA]), lysed by ultrasonic treatment and incubated with EZview anti-HA agarose beads (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 µg poly[d(I-C)] (Roche) competitor DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing grade endoproteinase Lys-C (Roche Diagnostics) and modified trypsin (Promega ...
-
bioRxiv - Biochemistry 2022Quote: ... c-Myc (Sigma PLA0001 or Roche 11667149001), Histone 3 (Sigma H0164) ...
-
bioRxiv - Pathology 2023Quote: ... α-c-Myc (1:2000, Roche diagnostics), DM1A (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-c-myc (Roche, #11667149001, 1:200), anti-MAP-2 (H-300 ...
-
bioRxiv - Biophysics 2021Quote: ... at one end through biotin-streptavidin interactions and to the anti-digoxigenin (Roche, Basel, Switzerland) coated coverglass surface at the other end through digoxigenin-antibody interactions ...
-
bioRxiv - Bioengineering 2022Quote: ... with the addition of one tablet of cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche), 1 unit of Pierce Universal Nuclease and 10 μg of lysozyme ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mM DTT) containing Complete™ Protease Inhibitor Cocktail (one tablet per 50 mL) (Roche) and disrupted by sonication (Branson Digital Sonifier ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with one EDTA-free protease inhibitor mini tablet / 5 ml of buffer (Roche #4693159001). Lysates were incubated on ice for 15 min ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mg/mL DNAse and one complete mini EDTA-free protease inhibitor cocktail tablet (Roche), by passing the sample three times through a pressurised cell disruptor (M110-L ...
-
bioRxiv - Biophysics 2021Quote: ... The resuspended cells were incubated on ice with one Complete EDTA-free protease inhibitor (Roche) tablet as well as with 100 U of DNAse (ArcticZymes ...
-
bioRxiv - Immunology 2020Quote: ... at 1:1,000 dilution in 1% BSA in PBS and One-step ABTS substrate (Roche). Non-PfCSP reactive antibody ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with 8 mL water plus one cOmplete™ Mini EDTA-free 11836170001 (Roche, Basel, Switzerland) protease inhibitor tablet) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10% glycerol) containing 0.1% NP-40 and one EDTA-free cOmplete protease inhibitor tablet (Roche). Cells were lysed by sonication and cleared by centrifugation for 1 h at 30,000xg ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μL Turbo nuclease (Accelagen) and one tablet of Complete EDTA-free protease inhibitor (Roche) (Cormier et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA prepared from these RNA isolations by KAPA SYBR® FAST One-Step kit (Roche) was analyzed directly by qPCR in Real-time PCR cycler RotorGene 3000 (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... pH 7.4 StlC) and with the addition of one tablet cOmplete Protease Inhibitor Cocktail (Roche) and lysozyme incubated for 20-50 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 25 mM Imidazole) supplemented with one complete EDTA-free protease inhibitor tablet (Roche, Basel, Switzerland), 0.1 mg/ml lysozyme ...
-
bioRxiv - Plant Biology 2023Quote: ... pH 7.4) with one dissolved tablet of EDTA-free cOmplete (Roche Diagnostics GmbH, Mannheim, Germany). Cell were incubated with 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2024Quote: ... 10% [v/v] glycerol) supplemented with one cOmplete EDTA-free protease inhibitor cocktail tablet (Roche) per 50 mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed using the extracted DNA (100 ng) as template with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Plant Biology 2019Quote: ... the cDNA samples were diluted with 220 µl distilled water and 2 μl aliquots were amplified with the LightCycler® Nano Real-time PCR Detection System (Roche Applied Science, Tokyo, Japan) using the KOD SYBR® qRT-PCR Mix (TOYOBO) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5X SSC, 5X Denhardt’s solution, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water). Incubation with pre-hybridization buffer was carried out during 4h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50% formamide, 5X SSC, 5X Denhardt’s, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water) containing biotin and/or digoxin labeled Locked Nucleic Acid (LNATM ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 mM NaCl, 1 mM MgCl2, 10 mM Imidazole, 0.5% IGEPAL® CA-630, 2 mM β-Mercapto-ethanol supplemented with Roche cOmplete inhibitor cocktail tablets) at a ratio of 15 ml of buffer/g of biomass ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg sequencing grade trypsin (Roche) was dissolved in 165 μL ice cold trypsin digestion buffer and added to resin in the spin columns with the bottom capped ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mg/mL DNAase (Roche, 04716728001). The cells were resuspended by mechanical agitation through Pasteur pipettes flamed with decreasing diameters ...
-
bioRxiv - Cell Biology 2021Quote: ... for 90 min at 37 °C and digested overnight at 37 °C in 1.5 mg/ml collagenase B solution (Roche). Then ...
-
bioRxiv - Cell Biology 2021Quote: ... for 90 minutes at 37°C and digested overnight at 37°C in 1.5 mg/ml collagenase B solution (Roche) under continuous agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...