Labshake search
Citations for Roche :
2151 - 2200 of 5929 citations for Recombinant HIV 1 gp120 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... 1 μl of 10 mM probe (Roche Universal ProbeLibrary), and 36 μl of 2.2X Master mix was dispensed into wells containing 4 μl aliquots of the dilution series or a 4 μl aliquot of distilled water for a negative template control ...
-
bioRxiv - Microbiology 2024Quote: ... 1 tablet Complete Ultra Protease Inhibitor Cocktail/PhosSTOP (Roche), ultrapure water) ...
-
bioRxiv - Microbiology 2023Quote: ... 1:1000 dilution of 1mg/ml DAPI (Roche Diagnostics) was included during Poly-L-Lysine labeling ...
-
bioRxiv - Genomics 2023Quote: ... 1% sodium deoxycholate) containing 1x protease inhibitor cocktail (Roche) for 30min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... and collagenase D (1 mg/mL; Roche, Basel, Switzerland) [9] ...
-
bioRxiv - Developmental Biology 2023Quote: ... Anti-Digoxigenin-POD Fab fragments (1:100) (Roche, 11207733910), and Goat α-mouse Alexa 488 (1:300 ...
-
bioRxiv - Neuroscience 2024Quote: ... protease inhibitor tablets (1 tbl/10 ml, #4693159001, Roche), AEBSF (1:100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... with antigen retrieval using Cell Conditioning 1 (CC1, Roche) for 48 minutes and primary antibody incubation for 60 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-HA (1:500; Roche, cat no:423001).
-
bioRxiv - Neuroscience 2024Quote: ... rehydration and permeabilization steps (1:3000 Proteinase K (Roche) in PBS-DEPC ...
-
bioRxiv - Neuroscience 2023Quote: ... sheep anti-Digoxigenin-POD (Roche Applied Science; 1:2,000), and sheep anti-Fluorescein-POD (Roche Applied Science ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 tablet of Complete Mini EDTA-free (11836153001, Roche). The embryos in CDS were flash frozen in liquid nitrogen and samples were stored at -80 °C until they were genotyped and could be combined according to their genotype for further usage ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% Triton X-100) supplemented with protease inhibitors (Roche). Immunoprecipitation ...
-
bioRxiv - Immunology 2023Quote: ... and incubated with 1 mg/ml collagenase D (Roche) and 0.1 mg/ml DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... EDTA-free protease inhibitor pellet (1 capsule/ 50ml, Roche)) and lysed by a cell disruptor ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1/5th volume of anti-GFP antibody (Roche) and 50μl of 0.1M Na-phosphate with gentle agitation for 30min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with collagenase D (1 mg/ml; Roche) in RPMI1640 medium at 37 °C for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25 or 0.17 mg ml−1 Liberase (Roche Diagnostics). The digested lungs were passed through a 1 ml syringe to make single-cell suspensions ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:50 protease inhibitor (Complete Tablets EASYpack; 04693116001; Roche), 1:100 Phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 mM phenylmethylsulfonyl fluoride (PMSF) (Roche, Cat # 10837091001). The lysate was passed 10 times through a 25-gauge needle ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and Complete protease inhibitor cocktail (Roche) at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and Complete protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Cell Biology 2020Quote: ... A 2ml Dounce homogenizer was used to individually homogenize each brain in a 1:1 solution of Lysis-R:2X-RIPA buffer solution with protease inhibitors (Roche cOmplete tablets #11836153001). Each sample was sonicated three times for 7 seconds and then centrifuged at 5000g for 5min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... They were allowed to equilibrate in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 1 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) over night at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then incubated overnight at 4°C in primary antibody dilutions in freshly prepared BBT+ buffer (PBST + 1% BSA + 0.5 mM Spermidine + 2 mM EDTA + 1 large Roche complete EDTA-free tablets). Primary antibody was replaced with BBT+ buffer and quickly washed twice ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were harvested and resuspended in binding buffer (100 mM Tris- Cl pH 8.0, 150 mM NaCl, 1 mM EDTA, complete protease inhibitor cocktail (Roche; 1 tablet/10 mL) before sonicating on ice ...
-
bioRxiv - Biochemistry 2021Quote: Bacteria were resuspended in 150 μL lysis buffer (1% Triton X100, 0.5% SDS, 1 tablet cOmplete EDTA-free protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany) in 10 mL PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... and sequentially incubated for 1 hour in a serum-based blocking solution and then for 1 hour in blocking solution containing the anti-digoxigenin (Roche, 11093274910; 1/2000) or anti-Fluorescein (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/ml SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... The final pellet containing the chromatin fraction was resuspended in lysis buffer (10 mM HEPES, 500 mM NaCl, 1 mM EDTA, 1% NP-40, supplemented with protease and phosphatase inhibitor cocktails, Roche, and Benzonase, Millipore), sonicated 3 times at low amplitude ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 0.5% SDS, 0.5% SDO, 1% Triton X-100, 1 mM PMSF, Roche cOmplete Mini Protease Inhibitors 1x), and homogenized (Precellys Evolution ...
-
bioRxiv - Biochemistry 2022Quote: ... The PVDF membrane was blocked with 5% skim milk in TBS for 1 h and incubated with anti-HA-HRP (Roche, 3F10, 1:5000) in 5% milk/TBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10% Glycerol, 1 % Triton-X-100, 1.5 mM MgCl2, 1 mM EGTA, 10 mM Pyrophosphate, 100 mM NaF, Roche protease inhibitor cocktail 1x), and protein level quantified using the Pierce BCA Assay Kit (Thermo Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were washed with cold 1X-PBS prior to collection with 800μL of chilled lysis buffer (50mM TRIS-HCl [pH=7.4]; 150mM NaCl; 1mM EDTA; 1mM CaCl2; 1mM MgCl2; 1% Triton, 0.5% sodium deoxycholate; protease inhibitor cocktail [Roche] 1 tablet/10mL lysis buffer). The cells were incubated on ice for 30 minutes and then centrifuged at 13,000 rpm/ 15minutes/ 4° C ...
-
bioRxiv - Neuroscience 2020Quote: ... 40 mM KCl, 5 mM EGTA, 5 mM MgCl2, 5 mM DTT, 1 mM PMSF, 1% Triton X, protease inhibitor Roche complete, pH 7.2) and sonicated at low power for 5 s ...
-
bioRxiv - Cancer Biology 2021Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/mL SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: GST-tagged CBX8 was purified by re-suspending thawed cell pellets in 30 ml of lysis buffer (1× PBS, 5 mM DTT, 1× EDTA free protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN)) per liter of culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets of harvested bacteria were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Microbiology 2020Quote: NUP153/NSP1-expressing cell pellets were resuspended in lysis buffer (1× PBS, 0.5 mM TCEP, 0.1 mM PMSF, 1× Roche cOmplete protease inhibitors, pH 7.4), and lysed in a homogenizer ...
-
bioRxiv - Genetics 2019Quote: ... Sheered chromatin samples were pre-cleared by incubating with the 250ul aliquot of Dynabeads resuspended in 2ml of Dilution Buffer (20mM Tris pH=8, 2mM EDTA, 150mM NaCl, 1% Triton X-100, 1:50 Roche cOmplete protease inhibitor) for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... and resuspended in 1 mL of buffer 1 (20 mM K-HEPES pH 7.9, 50 mM KCl, 10% glycerol, and Roche EDTA-free protease inhibitors). Subsequently ...
-
bioRxiv - Biophysics 2023Quote: ... 1% Triton X-100, 10% glycerol, 10 mM NaH2PO4, 10 mM NaP2O7, 100 μM ZnCl2, 10 mM NaF, 1 Roche protease inhibitor tablet), lysed by sonication and the supernatant isolated by centrifugation ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mM EDTA, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, protease inhibitor cocktail [Roche], and PhosStop [Roche]; pH 7.5) and sonicated for 30 s ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were lysed in lysis buffer (50 mM Tris/HCl, 1 mM EDTA, 1% SDS, phosphatase inhibitor cocktail (Roche, Indianapolis, IN, USA), and protease inhibitor cocktail (Roche) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in 10 ml of extraction buffer (pH 6.7) (250 mM sucrose, 120 mM KCl, 10 mM MOPS, 5 mM MgCl2, 1 mM DTT, 1 Roche protease inhibitor cocktail tablet) (Vought et al ...
-
bioRxiv - Cell Biology 2024Quote: ... Beads were spun down and washed twice in 1 mL of buffer (50 mM Hepes, pH 7.4, 150 mM NaCl, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001)) and subjected to sample preparation for MS measurement ...