Labshake search
Citations for Roche :
2101 - 2150 of 5933 citations for PD 1 Human C93S HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 1 tablet/50 mL cOmplete protease inhibitor cocktail (Roche), pH 7.4 ...
-
bioRxiv - Genetics 2023Quote: ... 1% NP-40) supplemented with cOmplete protease inhibitors (Roche) and incubated on ice ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 cOmplete mini EDTA-free protease inhibitor tablet (Roche), 1 phosphoSTOP phosphatase inhibitor tablet (Roche) ...
-
bioRxiv - Systems Biology 2023Quote: ... and 1× protease and phosphatase inhibitor mix (both Roche) for 15 minutes on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... 1× complete EDTA-free protease inhibitor cocktail tablet (Roche), 1% Triton X-100 ...
-
bioRxiv - Physiology 2023Quote: ... After blocking using 1% Roche blocking solution (Roche, 11096176001), sections were incubated for 3 hours with Anti-Digoxigenin-AP Fab fragments (dilution 1:3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% IGEPAL) supplemented with protease inhibitor cocktail (Roche 11873580001) was added to the lysed samples ...
-
bioRxiv - Pathology 2023Quote: ... 1% sodium deoxycholate) with protease and phosphatase inhibitors (Roche). Samples were precipitated with 95% acetone overnight at -20 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 cOmplete EDTA-free protease inhibitor Cocktail tablet (Roche), 1 mM DTT ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... 1% NP40) supplemented with protease inhibitors (Roche Mini tablets). The homogenate was supplemented with Benzonase nuclease (EMD Millipore (70664-3) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Anti-Digoxigenin-POD Fab fragments (1:100) (Roche, 11207733910), and Goat α-mouse Alexa 488 (1:300 ...
-
bioRxiv - Microbiology 2023Quote: ... and rat-anti-HA (1:1000 dilution, Roche, 11867423001). Secondary antibodies used were Alexa-546-anti-rabbit (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... and Arginase-1 (SP156, Roche, 760-4801, pre-diluted) and paired with R6G and Cy5 respectively ...
-
bioRxiv - Immunology 2023Quote: ... and 20µl DNAse 1 (10mg/ml, Roche, Cat# 10104159001), followed by automated tissue dissociation (GentleMacs ...
-
bioRxiv - Microbiology 2023Quote: ... 1 U/mL EDTA-free protease inhibitor cocktail (Roche) and 1mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × Complete EDTA-free protease inhibitor (Merck Millipore/Roche), 1 × PhosSTOP (Merck Millipore/Roche)] and homogenized with a Dounce homogenizer ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-HA (12CA5 mouse monoclonal antibody, Roche, 1:10.000), anti-Ubiquitin (P4D1 mouse monoclonal antibody ...
-
bioRxiv - Microbiology 2023Quote: ... 1 U/mL EDTA-free protease inhibitor cocktail (Roche) and 1mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × Complete EDTA-free protease inhibitor (Merck Millipore/Roche), 1 × PhosSTOP (Merck Millipore/Roche)] and incubated on ice for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... and collagenase D (1 mg/mL; Roche, Basel, Switzerland) [9] ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM DTT and cOmplete protease inhibitor cocktail (Roche). The lysis was performed for 15 min at 4°C ...
-
bioRxiv - Biophysics 2023Quote: ... protease inhibitors tablets (1 tablet per 50 ml, Roche), and 0.25 % IGEPAL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 × complete EDTA-free protease inhibitor (Roche Diagnostics), followed by sonication at a power of 100 W using an ultrasonic processor (SCIENTZ-950E ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1/5th volume of anti-GFP antibody (Roche) and 50μl of 0.1M Na-phosphate with gentle agitation for 30min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with collagenase D (1 mg/ml; Roche) in RPMI1640 medium at 37 °C for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Biochemistry 2023Quote: ... Following antibody incubation (anti-GFP, 1:1000, Roche #118144600001), membranes were developed in ECL and imaged using the Chemidoc imaging system (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... in 1× HiFi reaction buffer with MgCl2 (05917131103, Roche) were mixed with either 5’ sg RNA or 3’ sgRNA forward primer targeting the OvoA gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × Complete EDTA-free protease inhibitor (Merck Millipore/Roche), 1 × PhosSTOP (Merck Millipore/Roche)] and homogenized with a Dounce homogenizer on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1% NP-40) containing 1x complete Mini (Roche) and 1x PhosSTOP (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 × phosphatase inhibitor (PhosSTOP, 04906837001, Roche, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2024Quote: ... with antigen retrieval using Cell Conditioning 1 (CC1, Roche) for 48 minutes and primary antibody incubation for 60 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (Roche; 1 h at 55 °C) and DNA recovered using PCR purification kit (Qiagen).
-
bioRxiv - Immunology 2024Quote: ... cOmplete protease inhibitor (1 tablet / 10 ml) (Roche, 11697498001). Protein lysates were resolved on a NuPAGE™ 4 to 12% ...
-
bioRxiv - Microbiology 2024Quote: ... 1 tablet Complete Ultra Protease Inhibitor Cocktail/PhosSTOP (Roche), ultrapure water) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM EDTA and complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... with the following modifications: 1 x PhosSTOP (Roche, 4906845001) was included in all solutions up to and including the primary antibody incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 EDTA-free mini cOmplete EASYpack tablet (Roche 04693159001), and 1 mini PhoSTOP EASYpack tablet (Roche 04906845001) ...
-
bioRxiv - Immunology 2023Quote: ... enzymatic dissociation with 1 μg/ml Collagenase D (Roche) and 25 μg/mL DNAse I (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-HA antibody (3F10, Merck Millipore/Roche, 1/300), anti-Siwi antibody (1/400) ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 μl of 10 mM probe (Roche Universal ProbeLibrary), and 36 μl of 2.2X Master mix was dispensed into wells containing 4 μl aliquots of the dilution series or a 4 μl aliquot of distilled water for a negative template control ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM EDTA and 0.1% protease inhibitor cocktail (Roche)] and three times with 1 X PBS ...
-
bioRxiv - Physiology 2023Quote: ... a protease inhibitor (1 minitab per 10 mL, Roche), pH = 7 ...
-
bioRxiv - Genomics 2023Quote: ... 1% sodium deoxycholate) containing 1x protease inhibitor cocktail (Roche) for 30min on ice ...
-
bioRxiv - Neuroscience 2024Quote: ... rehydration and permeabilization steps (1:3000 Proteinase K (Roche) in PBS-DEPC ...
-
bioRxiv - Neuroscience 2024Quote: ... protease inhibitor tablets (1 tbl/10 ml, #4693159001, Roche), AEBSF (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-HA (1:500; Roche, cat no:423001).
-
bioRxiv - Neuroscience 2023Quote: ... sheep anti-Digoxigenin-POD (Roche Applied Science; 1:2,000), and sheep anti-Fluorescein-POD (Roche Applied Science ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25 or 0.17 mg ml−1 Liberase (Roche Diagnostics). The digested lungs were passed through a 1 ml syringe to make single-cell suspensions ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% Triton X-100) supplemented with protease inhibitors (Roche). Immunoprecipitation ...