Labshake search
Citations for Roche :
2101 - 2150 of 5049 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Linear NGS library construction was performed using a KAPA HyperPrep library kit (Roche) according to published protocols ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... constructed barcoded libraries for sequencing using KAPA HyperPrep kits (Roche Sequencing, Pleasanton, CA) with a target fragment size of 500 bp ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation was performed using a commercially available kit provided by KAPA Biosystems (KAPA Hyper Prep with Library Amplification Primer Mix ...
-
bioRxiv - Genomics 2022Quote: Libraries are quantified via qPCR using the KAPA Library Quantification Kit (Roche 0796020400), which specifically analyzes sequencing-competent fragments ...
-
bioRxiv - Genomics 2022Quote: BANC-seq libraries were prepared using the Kapa Hyper Prep Kit (Kapa Biosystems) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was done with the SYBR Green I Master kit (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... LDH release levels were analyzed using a Cytotoxicity Detection Kit (Roche, Basel, Switzerland). Purified Ply(1μM)was co-cultured with various concentrations of alnustone at 37°C for 30min ...
-
bioRxiv - Microbiology 2022Quote: ... The KAPA HiFi Hot Start Ready Mix kit (Kapa Biosystems, Woburn, MA, USA) was used for PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Microbiology 2022Quote: ... JE1 amylase activities were measured in culture supernatants using the AMYL kit (Roche/Hitachi #11876473 001 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was generated by using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed using FastStart SYBR green master mix (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Pathology 2022Quote: ... and quantified using the KAPA Library quantification kit for Illumina platforms (KAPA Biosystems). One hundred base pair single-read sequencing of multiplexed samples was performed on an Illumina HiSeq 4000 sequencer ...
-
bioRxiv - Plant Biology 2022Quote: ... The library was quantified with the KAPA Library Quantification Kit (Roche, Basel, Switzerland), and the fragment size of the library was verified using an Agilent Technology 2100 bioanalyzer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mRNA was isolated with an mRNA Isolation Kit (Roche, # 11 741 985 001) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the LightCycler Fast Start DNA Master SYBR Green I kit (Roche Diagnostics) as previously described (Maire et al. ...
-
bioRxiv - Microbiology 2022Quote: ... LDH in the cell supernatants was quantified using the Cytotoxicity Detection kit (Roche), following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The libraries were constructed using the KAPA HyperPlus Library Preparation Kit (KAPA Biosystems) and sequenced using the Illumina HiSeq 4000 platform (with 150 bp paired-end reads) ...
-
bioRxiv - Microbiology 2023Quote: ... with a KABA SYBR Fast Universal qPCR Kit (Kapa Biosystems, Wilmington, MA, USA) was used for quantification ...
-
bioRxiv - Biochemistry 2023Quote: ... Probe detection was performed using the DIG luminescent detection kit (Roche, Penzberg, Germany) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Ribosomal RNA was removed using KAPA RNA HyperPrep kit (Roche, cat. no. kk8561). Approximately 40 million paired- end reads per sample (2×150bp ...
-
bioRxiv - Genomics 2022Quote: ... Immunoprecipitated DNA was processed for library preparation (KAPA library preparation kit, KK8234, Roche). In the case of GR and RAD21 ChIPs ...
-
bioRxiv - Developmental Biology 2023Quote: ... and complimentary DNA libraries were prepared using the KAPA RNA HyperPrep Kit (Roche) according to manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCRs were carried out using the KAPA3G Plant PCR Kit (Kapa Biosystems, VWR) using the following cycling conditions for the phylogenetically informative loci ...
-
bioRxiv - Genomics 2023Quote: ... We used the KAPA Library Quantification Kit for Illumina® platforms (Roche, KK4854) on the LightCycler 480 and diluted the pools to 2nM (HCC38 samples ...
-
bioRxiv - Genetics 2022Quote: ... PCRs were carried out using a KAPA HiFi PCR Kit from KAPA Biosystems. The restriction enzyme FastDigest Esp3I (namely ...
-
bioRxiv - Genomics 2023Quote: ... cDNA libraries were prepared using the KAPA Stranded RNA-Seq Kit (Roche; 07962142001). Libraries were quantified using a KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Brightfield slides utilized A ChromoMap DAB (3,3′-Diaminobenzidine) Kit-Catalog #760-159 (Roche) to form a brown precipitate at the site of primary-secondary antibody complexes containing HRP ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Ultra View Universal DAB Detection Kit (#5269806001, Roche Diagnostics, Rotkreuz, Switzerland) for antibody detection ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared using the KAPA Hyper Library Preparation kit (KAPA Biosystems). Shotgun metagenomic sequencing was carried out on Illumina NovaSeq 6000 ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was amplified using KAPA HiFi HotStart PCR kit (Kapa Biosystems, KK2501) according to the manufacturer’s guidelines and specific primers flanking the CRISPR cut site (with the CRISPR cut site off center ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each sample was then qPCR quantified using KAPA Library Quantification Kit (KAPA Biosystems). Samples were then pooled together and quantified again using the KAPA Library Quantification Kit ...
-
Deciphering the gene regulatory circuitry governing chemoresistance in Triple-Negative Breast CancerbioRxiv - Cancer Biology 2023Quote: ... and a cytotoxicity assay was performed using an MTT assay kit (Roche, 11465007001) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Prepared insert and vector fragments were ligated using Rapid DNA Ligation Kit (Roche), transformed to One Shot TOP10 Chemically Competent E ...
-
bioRxiv - Immunology 2023Quote: ... and reverse-transcribed to cDNA with Transcriptor First Strand cDNA Synthesis Kit (Roche) per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... PCRs were performed using a KAPA SYBR FAST qPCR Kit (KAPA Biosystems, USA) with the Thermal Cycler Dice Real Time System (Takara) ...
-
bioRxiv - Immunology 2024Quote: ... the DNA libraries were prepared using the KAPA HyperPrep Kit (Roche, Basel, Switzerland) following the manufacturer’s instructions and sequenced on the Illumina NovaSeq platform with a 150 bp paired-end strategy ...
-
bioRxiv - Genetics 2024Quote: ... and a KAPA SYBR FAST Universal qPCR Kit (Kapa Biosystems, Boston, MA, USA) were used ...
-
bioRxiv - Cell Biology 2024Quote: ... and quantified using the KAPA Library Quantification kit for ABI Prism (Roche, KK4854). ATAC libraries were pooled at equimolar ratios prior to sequencing in a HiSeq4000 instrument with paired-end 50bp reads at the Genomics Unit of the Centre for Genomic Regulation (Barcelona ...
-
bioRxiv - Genomics 2024Quote: ... PolyA-selected libraries were prepared using the KAPA stranded mRNA kit (Roche # 07962207001) and sequenced using the NOVASeq-S1 paired-end 100 platform ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... converted to cDNA using KAPA mRNA HyperPrep kit (KAPA biosystems, Cat. No. KK8580), and indexed-adapter ligated with KAPA single-indexed adapter kit (KAPA biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... an equal volume of luciferase reagent (ATP Bioluminescence Assay Kit HS II, Roche) was added to each supernatant ...
-
bioRxiv - Plant Biology 2024Quote: ... and the KAPA Library Quantification Kit-Illumina/ABI Prism User Guide (Kapa Biosystems). Library construction was generated from cDNA fragments adenylated at their 3′-ends and ligated with indexing adapters ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were prepared using the KAPA HTP Library Preparation Kit (KAPA Biosystems). Barcoded libraries were run on NovaSeq 6000 in a PE100 run ...
-
bioRxiv - Cancer Biology 2024Quote: Cell proliferation was measured by using the MTT assay kit (Roche, cat. 11465007001). Cells were cultured in 96-well plates at a density of 2000 cells per well overnight in an incubator with 5% CO2 at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ChIP-seq DNA libraries were prepared using the KAPA HyperPrep Kit (Roche, # KK8504) and sequenced on the Illumina NextSeq 500 system ...
-
bioRxiv - Neuroscience 2024Quote: ... and their concentrations were measured using the KAPA SYBR Fast qPCR kit (Roche). Samples were sequenced on the NovaSeq 6000 instrument (paired end ...
-
bioRxiv - Molecular Biology 2024Quote: ... and quantified by qPCR using KAPA Library Quantification Kits (Kapa Biosystems, Cat# KK4824). The library was sequenced on the Illumina NovaSeq 6000 for 51 cycles of paired-end sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... The mRNA library was prepared using the Kapa mRNA HyperPrep Kit (Kapa Biosystems) and sequenced on the Illumina HiSeq 3000 system ...