Labshake search
Citations for Roche :
2051 - 2100 of 6336 citations for Progesterone ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: DNA was purified from virus-infected Vero cells stock by a commercially available kit (High Pure Extraction Kit; Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: RNA-seq libraries and libraries containing both ATAC-seq and TaPE-seq were quantified by qPCR using the KAPA Library Quantification Kit (Complete kit, Universal) (F. Hoffmann-La Roche AG, Basel, Switzerland) on the CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories Inc ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were purified by using a High Pure PCR product purification kit (B A High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and purified products were sequenced directly using an ABI BigDye Terminator Cycle Sequencing Kit ver ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA libraries were created from 150 ng of total RNA using the KAPA RNA HyperPrep Kit with RiboErase kit (Roche Diagnostics, Vilvoorde, Belgium), according to the manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic DNA was used for NGS library preparation using either the KAPA Library Preparation kit or the KAPAHyperPlus kit (KAPA Biosystems, MA, USA). Genomic libraries were captured with the HyperPlus Capture Exome Kit or the xGen Exome Panel V2 (Integrated DNA Technology ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... Coralville, Iowa, USA) and 0.25 µl reverse primer (5 µM, IDT) and was analyzed on a LC480 instrument (Roche, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2021Quote: C2C12 cell lysate was generated using 5 million cells in RIPA lysis buffer with protease/phosphatase inhibitors (Roche #11836145001 and #04906837001), and 20μg of protein was loaded on a denaturing SDS page gel for detection of the VGLL2-NCOA2 fusion ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR reactions were conducted in a 10-µL final volume with 5 µL of 2X FastStar Universal SyBR green Master (Roche, Switzerland), 1.5 µL of forward/reverse primer mix (Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... After that pelleted beads were gently resuspended in washing buffer containing 4xTBS, 5% NP-40, phosphatase inhibitors (10mM NaF, 1mM Na3VO4) and protease inhibitors (cOmplete®, Roche) and washed 10 times with gentle agitation ...
-
bioRxiv - Plant Biology 2019Quote: ... Blots were blocked for at least 1 hour in blocking solution at RT (5% milk in 1xTBS) before probing with primary antibody in blocking solution (α-HA-HRP, 1:2500 (Roche); α-PGB1 ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... The tissue was homogenized in homogenization buffer (20 mM HEPES, pH 7.4; 320 mM sucrose, 5 mM EDTA) supplemented with protease inhibitors (Roche, Cat #11697498001) using a glass Dounce homogenizer ...
-
bioRxiv - Plant Biology 2019Quote: ... Total proteins from 120 seedlings were extracted with 150 µL of extraction buffer (50 mM Tris-HCl pH 7.4, 80 mM NaCl, 0.1 % Tween 20, 10 % glycerol, 10 mM dithiothreitol, 2× Protease inhibitor cocktail [11873580001, Roche], 5 mM PMSF). Prior to protein quantification ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 cycles of primary PCR to amplify the region of interest was performed using 2 μL of DNeasy eluate (∼100–300 ng template) in a 5 μL Kapa HiFi HotStart polymerase reaction (Kapa Biosystems; for primers see Supplementary Data Set 1) ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... before lysis in swelling buffer (5 mM PIPES pH8.0, 85mM KCl) freshly supplemented with 1x protease inhibitor cocktail (Roche, cat. 04693116001) and 0.5% NP-40 ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed twice in PBS and resuspended in 100 μL annexin V incubation buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) containing 1% annexin V FLOUS (Roche Molecular Biochemicals) and 500 μg/μl PI stain ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Developmental Biology 2021Quote: ... The tissue was then washed with PBST extensively (10 times or more for 5 minutes) before development with BM-purple (1ml peer well, Roche Diagnostics). Time of development was approximately 24 hours at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 148.5 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 1x PhosSTOP Roche, 5x cOmplete protease inhibitor cocktail Roche, 1 mM DTT) using a cell scraper (TPP 99003) ...
-
bioRxiv - Microbiology 2022Quote: ... The capsids were suspended in sample buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, PIs [Roche cOmplete]), and adsorbed to nitrocellulose membranes (BioTrace™ ...
-
bioRxiv - Microbiology 2022Quote: The samples were lysed in Laemmli buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, bromophenol blue, PIs [Roche cOmplete]). The proteins were separated on linear 7.5 to 12% or 10 to 15% SDS-PAGE ...
-
bioRxiv - Microbiology 2022Quote: ... 50 µl of the post-nuclear supernatant was saved as the input lysate and 450 µl was incubated with 5 µg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 mL of digestion Buffer containing collagenase D (2mg/mL, Roche #11088858001) and DNase (0.125 mg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were re-suspended in 1 mL lysis buffer (5 mM EDTA, 1% NP-40 in PBS) supplemented with 2X cOmplete™ inhibitor (Roche) and were sonicated until the lysate became turbid ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.5% Triton X-100, 100 mM NaF, 1 mM ortho-vanadate, 2 mM EDTA, and a protease inhibitor cocktail [Roche 11836153001]). Lysates were vortexed and cleared by centrifugation (15,000 x g for 15 min at 4°C) ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were pelleted by centrifugation at 2500g for 5 minutes and resuspended in 880ul Nuclear Lysis Buffer (50mM Tris HCl, 10mM EDTA, 1% SDS, 1X protease inhibitors (Roche, 04693124001)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Neuroscience 2020Quote: ... nt 1280-1350 from sequence NM_008553 detected with the mASCL1 probe (Universal Probe Library probe #74, Roche, Cat.No. 04688970001; 5′-(Fam)-GGCAGCAG-(Dark Quencher)-3′) ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... Telomeric repeats were probed by incubating the membrane with telomeric probe containing digoxigenin (5’CCCTAACCCTAACCCTAACCCTAA-DIG; Integrated DNA Technologies, Coralville, IA; Table S1) overnight at 42°C DIG Easy Hyb™ buffer (Roche). Blots were washed in 2X saline-sodium citrate (SSC ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: Re-amplification of primary WTA products was performed in a reaction volume of 50 μl comprising 5 μl Expand Long Template Buffer 1 (Expand Long Template PCR System, Roche Diagnostics), 6 μl of CP2-15C or CP2-9C primer (2.88 μM ...
-
bioRxiv - Immunology 2020Quote: ... The resulting membrane pellet was resuspended in ice cold 500 μl TNE buffer (10 mM Tris/Cl [pH 7.4], 150 mM NaCl, 5 mM EDTA, 1% Triton X-100 [Sigma], 10X protease inhibitors [Complete tablets, Roche, Indianapolis, IN]). Sucrose gradients for the preparation of lipid rafts were assembled previously described (18) ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed with buffer MB#1 (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.2% NP-40, 1x Roche complete EDTA-free). Chromatin was fragmented with MNase for 10 min at 37°C and digestion was stopped with 5 mM EGTA at 65°C for 10 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription products were then amplified by quantitative PCR (95 °C, 5 minutes; 95 °C, 15 seconds; 60 °C, 60 seconds; 40 cycles) (LightCycler® 480, Roche) using TaqMan Universal PCR Master Mix and specific probes for miRNAs ...
-
bioRxiv - Plant Biology 2020Quote: ... Bacteria were pelleted and resuspended in lysis buffer (30 mM Tris pH 7.5, 450 mM NaCl, 5 mM β-mercaptoethanol, complete™ EDTA-free Protease Inhibitor Cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Biochemistry 2019Quote: ... microtubules were treated with 200 μg/mL subtilisin for 45 min at 303 K as described previously.28 Proteolysis was stopped with the addition of 5 mM PMSF (Roche Diagnostics). Subtilisin-treated microtubules were spun at 100,000xg for 30 min at 298 K and were resuspended in reaction buffer at 5 mM MgCl2 ...
-
bioRxiv - Genomics 2019Quote: ... after cells were lysed with Farnham Lysis Buffer (5 mM HEPES pH 8.0, 85 mM KCl, 0.5% IGEPAL, Roche Protease Inhibitor Cocktail), and nuclei were resuspended in RIPA buffer (1x PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... cells were incubated for 48 h at 37°C in 5% CO2, harvested and lysed using M-PER Mammalian Protein Extraction Reagent (Thermo Scientific, 78501) (with 1X Roche Complete Protease Inhibitor and 100 mM NaCl) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Quantitative Real-time PCR reactions were prepared manually in a total volume of 10 µl by mixing 5 µl 2x KAPA SYBR FAST ABI Prism master mix (KAPA Biosystems), 0.2 µl forward and reverse primer mix (10 µM each primer) ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). Human cells from differentiation experiments were also lysed in 300 µl Tri-Reagent for 5 minutes at RT mechanically dissociated/lysed using a sterile scraper ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Plant Biology 2022Quote: ... RT was performed with 5 µg of total mRNA using Transcriptor Reverse Transcriptase and oligo (dT)15 primer (Roche, Mannheim, Germany). QRT-PCR was run on a LightCycler 480 (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg of plasmid DNA was transfected into HMEC P5 was transduced into Phoenix packaging cells using Fugene (Roche, Basel, Switzerland). Viral supernatant was harvested 48 h after transfection ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...