Labshake search
Citations for Roche :
2051 - 2100 of 2352 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001). The supernatants were collected and the beads washed (50μL ...
-
bioRxiv - Neuroscience 2021Quote: ... participants were given either a total of 225mg of L-DOPA (Madopar, Roche, Levodopa/Benserazid, 4:1 ratio) or a placebo (P-Tabletten white 8mm Lichtenstein ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs or plasmid DNAs using Dharmafect 4 (Dharmacon) or Fugene 6 (Roche Applied Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were then probed overnight at 4℃ in anti-GFP (mouse monoclonal IgG1κ, cat#: 11814460001 Millipore Sigma/Roche) diluted 1:1000 in 5% Applichem nonfat dried milk in TBS-T ...
-
bioRxiv - Microbiology 2021Quote: ... The total qPCR reaction volume was 25 μl and consisted of 4 μl DNA (2,5 ng μl-1) and 12,5 μl LightCycler 480 SYBR Green I Master mix (Roche) containing 0.2 μM PCR primer (Table S5 ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Immunology 2020Quote: ... 1 μM of each primer combination and 4 μL of Lightcycler FastStart DNA MasterPLUS SYBR Green I (Roche) in a total volume of 20 μL ...
-
bioRxiv - Neuroscience 2020Quote: ... with 0.34 mg/ml nitroblue tetrazolium (NBT) and 0.35 mg/ml 5-bromo-4-chloro-3indolyl-phosphate (BCIP; Roche), for 1–12 hours at room temperature with gentle agitation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Cell Biology 2021Quote: ... was homogenized and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and chromatin was extracted overnight at 4°C in 0.5X PBS (67.5 mM NaCl) with a protease inhibitor cocktail (Roche) on an end-over-end rotator ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with DNAse I (4 U/ul) and 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tablet (Roche). The sample was lysed by French press at 17 KPsi (Constant Systems Ltd) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections on slides were post-fixed at 4% PFA in 0.1M PB and treated with proteinase K (Roche). Sections were hybridized with digoxigenin (DIG)-labeled probes at 72°C overnight in hybridization solution ...
-
bioRxiv - Physiology 2023Quote: ... Tissues were chopped with scissors and digested in a cocktail containing 4 units/mL LiberaseTM (Roche; Catalog# 355374) and 0.744 units/mL Elastase (Worthington Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µl cDNA and 5 µl of LightCycler 480 SYBR Green I Master mix (Roche Diagnostics GmbH, Germany). Three technical replicates of each sample were included ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 8.5 was added and this reaction was treated with 4 Units of Alkaline Phosphatase (Roche Life Science) at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... After homogenizing the tissue in ice-cold PBS with protease inhibitors (1mM PMSF; Phosphatase Inhibitor Cocktail 3, Sigma-Aldrich; Complete, Roche), the extracts were crosslinked with 1% formaldehyde for 10 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... cells at 40% confluency were transfected with 1 µg of mammalian expression plasmid DNA containing gene of interest using 3 µL X-tremeGENE 9 DNA transfection reagent (Roche, 6365809001) diluted in 100 µL 1x OPTI-MEM I reduced serum medium (Gibco ...
-
bioRxiv - Systems Biology 2024Quote: ... (after a 3-hour fasting period) was measured by taking blood from the tail tip using an Accu-Chek glucometer (Roche Diagnostics). Mice then received an intraperitoneal (ip ...
-
bioRxiv - Molecular Biology 2020Quote: Cryosections (10μM) of ventricular tissue were fixed in 4% paraformaldehyde and stained with In-situ Cell Death Detection kit (Roche). Sections were imaged on a laser-scanning confocal microscope (LSM 510 ...
-
bioRxiv - Cell Biology 2020Quote: ... Magnetic beads were washed 2 times with lysis buffer and 4 times with washing buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mg/ml Pefabloc SC (Roche), and EDTA-free protease inhibitor cocktail (cOmplete Tablets ...
-
bioRxiv - Genetics 2021Quote: ... Then they were incubated overnight at 4°C with primary antibodies diluted in a dilution buffer (0.5% blocking reagent (Roche), 2% fetal bovine serum ...
-
bioRxiv - Developmental Biology 2020Quote: ... the embryos were washed and equilibrated in NTMT buffer followed by coloration with 4-nitro blue tetrazolium (NBT, Roche) and 5-Bromo-4chloro-3-indolyl-phosphate ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 1 h and then incubated overnight at 4 °C in block solution with diluted DIG-antibodies (1:5,000) conjugated with alkaline phosphatase (AP) (Roche). To visualize WISH signal ...
-
bioRxiv - Immunology 2021Quote: Mouse tracheal epithelial cells were isolated from tracheas digested overnight at 4 °C in Ham’s F12 medium plus pronase (1 mg/ml; Roche). Cells were cultured for 3 h on Primaria plates (Falcon ...