Labshake search
Citations for Roche :
2001 - 2050 of 10000+ citations for Rat Indoleamine 2 3 Dioxygenase 1 IDO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Faa1 membrane binding drives positive feedback in autophagosome biogenesis via fatty acid activationbioRxiv - Biochemistry 2023Quote: ... 2 mM MgCl2) and finally resuspended in lysis buffer containing complete protease inhibitors (Roche), an FY-inhibitor mix (Serva) ...
-
bioRxiv - Microbiology 2023Quote: ... DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were incubated in blocking solution (10% sheep serum, 2% blocking reagent (Roche), 0.3% Tween-20 in MAB ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... qPCR was performed using SYBR FAST ABI Prism 2× qPCR Master Mix (Kapa BioSystems). Amplification was carried out in a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 uL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-PARP1 1:1000 (1 835 238 Roche), anti-tubulin 1:5000 (B-5-1-2 Santa Cruz) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (mouse, Roche AB_390913, Substrate 1:1); anti-actin (mouse ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-HRP (Roche, 12013819001, 1:1,000-1:5,000), MPP6 (Atlas antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Cancer Biology 2021Quote: ... The exome captured by the SeqCap wash kit and SeqCap pure capture bead kit (both from Roche). The Illumina Novaseq platform was used to sequence 150 bases (paired-end sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was isolated using a commercial extraction kit (High Pure PCR template preparation kit; Roche Diagnostics). Indexed paired-end libraries were preparedwith the Nextera XT DNA library preparation kit (Illumina Inc ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Purified DNA pools were further processed using the DNA library preparation kit Kapa Hyper Prep kit (Roche), during which each pool was indexed using SeqCap Adapter Kit A/B (Nimblegen ...
-
bioRxiv - Plant Biology 2022Quote: ... The EMSA was carried out utilizing the manufacturer’s instructions (DIG-gel shift kit 2nd generation kit, Roche).
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and then the detection reaction was carried out in a buffer containing 3.5 µl/ml of of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Bâle, Switzerland). The reaction was stopped with 50 mM EDTA in PBS and embryos were washed in PBSTw ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... beads were collected using a magnet stand at 4 °C and washed 3 times with beads wash buffer (sperm dilution buffer supplemented 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, # 4693132001), 1x PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Plant Biology 2023Quote: ... Meristem-enriched samples or whole seedlings were ground in liquid nitrogen and homogenized in cold protein extraction buffer (50 mM Tris HCl pH 7.5, 10% glycerol, 1 mM DTT, 1% IGEPAL, 1× Roche EDTA-free protease inhibitor and 1× Roche phosphatase inhibitor). The homogenate was centrifuged and the protein concentration of the supernatant was measured using a Pierce 660 nm Protein Assay Reagent (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.05% NP-40, 10% glycerol, 1×Roche protease inhibitor cocktail). Cell lysates were prepared by bead-beating ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM EDTA, 1 mM EGTA, 1.5 mM MgCl2, 1% Triton X-100, 10% Glycerol, 1 mM DTT, Roche complete protease inhibitor) with 0.5 mg/mL Lysozyme and placed on a roller for 45 minutes at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.05% NP-40, 10% glycerol, 1×Roche protease inhibitor cocktail) and were lysed by beating with 0.5-mm-diameter glass beads using a FastPrep instrument at a speed of 6.5 m/s for three cycles of 20 seconds each ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1 mM EDTA, 1mM EGTA, 1% Triton X-100, 0.4% SDS, 1% NP-40, 1× Roche protease inhibitor cocktail), one time with wash buffer B (50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM PMSF with 1 X protease inhibitors (Roche) and incubated with 5-10 μg of purified MBP-tagged anillin or GST-tagged importin-β protein on beads at 4°C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 X protease and 1 X phosphatase inhibitors (Roche), 10 % v/v glycerol) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HA tag (Roche 11666606001, 1:1,000 or 1:3,000), His tag (Abcam ab18184 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mg.mL−1 SDS) with Complete protease inhibitors (Roche). Equal amounts of protein (BCA protein assay ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 1 mg ml-1 collagenase/dispase (Roche) and 0.1 mg ml-1 DNase I (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM DTT and 1 × protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD68 (clone KP-1 at 1:20, Ventana- Roche), FOLR2 (OTI4G6 at 1:200 ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with collagenase D (1 mg ml−1, Roche) and DNase I (0.25 mg ml−1 ...
-
bioRxiv - Genomics 2019Quote: ... using the DNA 1000 kit and quantified by qPCR using the KAPA Library quantification kit (Roche, ref. KK4824). The library was sequenced on one lane of Hiseq2500 in single read 100nt mode using the clustering and SBS v3 kit following the manufacturer’s instructions.