Labshake search
Citations for Roche :
2001 - 2050 of 6565 citations for Estrone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: Libraries were prepped using the KAPA HyperPlus kit (Roche). To prepare genomic libraries ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Kapa DNA quantification kit for Illumina platforms (Roche). Libraries were pooled according to target cell number loaded for a sequencing depth of 20K-25K (for scRNA-seq ...
-
bioRxiv - Cancer Biology 2023Quote: ... and quantified (KAPA SYBR® FAST qPCR kit, Roche). Sequencing was performed with the NextSeq 500/550 High Output v2 kit for 75 cycles (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and quantified (KAPA SYBR® FAST qPCR kit, Roche). Sequencing was performed with the NextSeq 500/550 High Output v2 kit for 150 cycles (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... and signal development using Discovery Cy5 Kit (RTU, Roche-Ventana Medical Systems ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the KAPA Library Quantification Kit (Roche Cat. # 7960140001). Finally ...
-
bioRxiv - Cancer Biology 2024Quote: Libraries were generated using the KAPA HyperPrep kit (Roche) following manufacturer’s instructions and captured with KAPA HyperExome following manufacturer’s instructions (KAPA HyperCap workflow v3 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... prepared for sequencing using a KAPA HyperPrep kit (Roche) and sequenced on an Illumina MiSeq system ...
-
bioRxiv - Genomics 2024Quote: ... and KAPA Real Time Library Amplification Kit (KAPA Biosystems) following manufacturers manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... quantified with the KAPA Library Quantification Kit (KAPA Biosystems), and prepared for sequencing according to the standard normalization method described in “NextSeq 500 and NExtSeq 550 Sequencing Systems - Denature and Dilute Libraries Guide” ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Chromo-Map Kit (Reference: 760-159, Roche). The primary antibody (Ki67 ...
-
bioRxiv - Cancer Biology 2023Quote: ... capture pools were quantitated via qPCR (KAPA Biosystems kit), and the final product was sequenced using an Illumina HiSeq 2500 1T instrument (multiplexing nine tumor samples per lane) ...
-
bioRxiv - Microbiology 2023Quote: ... or the SeqCap RNA Developer Enrichment Kit (Roche NimbleGen). Before library construction ...
-
bioRxiv - Genomics 2024Quote: ... Sequencing libraries were prepared using KAPA Hyper kit (Roche) and genome sequencing was performed by the Norwegian Sequencing Centre (NSC ...
-
bioRxiv - Developmental Biology 2024Quote: ... or Nimblegen SeqxCap EZ MedExome Target Enrichment Kit (Roche), followed by Illumina DNA sequencing as previously described 56–58 ...
-
bioRxiv - Plant Biology 2024Quote: ... using the KAPA SYBR Fast qPCR kit (KAPA Biosystems) and gene-specific primer sets (Supplementary Table S3) ...
-
bioRxiv - Cell Biology 2024Quote: ... and SYBR Green I Master Kit (Roche; Cat #04887352001) was used to carry out the reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... we applied the KAPA Library Quantification Kit (Kapa Biosystems) to ensure library quality for sequencing.
-
bioRxiv - Bioengineering 2024Quote: ... using the KAPA SYBR FAST qPCR kit (Roche, #KK4601). Data were analysed using the 2^(ΔΔCt ...
-
bioRxiv - Physiology 2024Quote: ... assessed by Q-PCR KAPA Library Quantification kit (Roche) and with a run test using the iSeq100 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... the Cell proliferation Kit II (XTT) (Roche, Basel, Switzerland) was used ...
-
bioRxiv - Genomics 2024Quote: Libraries were prepared using Kapa HyperPrep Kit (Kapa Biosystems) with SeqCap Adapter Kit (Roche) ...
-
bioRxiv - Plant Biology 2024Quote: ... were added using the Kapa Hyper Prep Kit (Roche). The ligation products were purified twice with 1X AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2020Quote: Cell proteins were extracted by Pierce™ Classic Magnetic IP/Co-IP Kit (Thermo Scientifi, 88804) or Complete™ Lysis-M EDTA-free kit (Roche, 04719964001) according to the manuals ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of beta-globin was performed by a commercially available human genomic DNA kit (The LightCycler Control Kit DNA, Roche Diagnostics, Basel, Switzerland)69.
-
bioRxiv - Developmental Biology 2024Quote: ... RNA libraries were created from 150 ng of total RNA using the KAPA RNA HyperPrep Kit with RiboErase kit (Roche Diagnostics, Vilvoorde, Belgium), according to the manufacturer’s directions ...
-
bioRxiv - Immunology 2023Quote: RNA-seq libraries and libraries containing both ATAC-seq and TaPE-seq were quantified by qPCR using the KAPA Library Quantification Kit (Complete kit, Universal) (F. Hoffmann-La Roche AG, Basel, Switzerland) on the CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories Inc ...
-
bioRxiv - Microbiology 2023Quote: DNA was purified from virus-infected Vero cells stock by a commercially available kit (High Pure Extraction Kit; Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were purified by using a High Pure PCR product purification kit (B A High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and purified products were sequenced directly using an ABI BigDye Terminator Cycle Sequencing Kit ver ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic DNA was used for NGS library preparation using either the KAPA Library Preparation kit or the KAPAHyperPlus kit (KAPA Biosystems, MA, USA). Genomic libraries were captured with the HyperPlus Capture Exome Kit or the xGen Exome Panel V2 (Integrated DNA Technology ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... Coralville, Iowa, USA) and 0.25 µl reverse primer (5 µM, IDT) and was analyzed on a LC480 instrument (Roche, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2021Quote: C2C12 cell lysate was generated using 5 million cells in RIPA lysis buffer with protease/phosphatase inhibitors (Roche #11836145001 and #04906837001), and 20μg of protein was loaded on a denaturing SDS page gel for detection of the VGLL2-NCOA2 fusion ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR reactions were conducted in a 10-µL final volume with 5 µL of 2X FastStar Universal SyBR green Master (Roche, Switzerland), 1.5 µL of forward/reverse primer mix (Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... After that pelleted beads were gently resuspended in washing buffer containing 4xTBS, 5% NP-40, phosphatase inhibitors (10mM NaF, 1mM Na3VO4) and protease inhibitors (cOmplete®, Roche) and washed 10 times with gentle agitation ...
-
bioRxiv - Plant Biology 2019Quote: ... Blots were blocked for at least 1 hour in blocking solution at RT (5% milk in 1xTBS) before probing with primary antibody in blocking solution (α-HA-HRP, 1:2500 (Roche); α-PGB1 ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... The tissue was homogenized in homogenization buffer (20 mM HEPES, pH 7.4; 320 mM sucrose, 5 mM EDTA) supplemented with protease inhibitors (Roche, Cat #11697498001) using a glass Dounce homogenizer ...
-
bioRxiv - Plant Biology 2019Quote: ... Total proteins from 120 seedlings were extracted with 150 µL of extraction buffer (50 mM Tris-HCl pH 7.4, 80 mM NaCl, 0.1 % Tween 20, 10 % glycerol, 10 mM dithiothreitol, 2× Protease inhibitor cocktail [11873580001, Roche], 5 mM PMSF). Prior to protein quantification ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 cycles of primary PCR to amplify the region of interest was performed using 2 μL of DNeasy eluate (∼100–300 ng template) in a 5 μL Kapa HiFi HotStart polymerase reaction (Kapa Biosystems; for primers see Supplementary Data Set 1) ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... before lysis in swelling buffer (5 mM PIPES pH8.0, 85mM KCl) freshly supplemented with 1x protease inhibitor cocktail (Roche, cat. 04693116001) and 0.5% NP-40 ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed twice in PBS and resuspended in 100 μL annexin V incubation buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) containing 1% annexin V FLOUS (Roche Molecular Biochemicals) and 500 μg/μl PI stain ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Developmental Biology 2021Quote: ... The tissue was then washed with PBST extensively (10 times or more for 5 minutes) before development with BM-purple (1ml peer well, Roche Diagnostics). Time of development was approximately 24 hours at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 148.5 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 1x PhosSTOP Roche, 5x cOmplete protease inhibitor cocktail Roche, 1 mM DTT) using a cell scraper (TPP 99003) ...
-
bioRxiv - Microbiology 2022Quote: ... The capsids were suspended in sample buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, PIs [Roche cOmplete]), and adsorbed to nitrocellulose membranes (BioTrace™ ...
-
bioRxiv - Microbiology 2022Quote: The samples were lysed in Laemmli buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, bromophenol blue, PIs [Roche cOmplete]). The proteins were separated on linear 7.5 to 12% or 10 to 15% SDS-PAGE ...
-
bioRxiv - Microbiology 2022Quote: ... 50 µl of the post-nuclear supernatant was saved as the input lysate and 450 µl was incubated with 5 µg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 mL of digestion Buffer containing collagenase D (2mg/mL, Roche #11088858001) and DNase (0.125 mg/mL ...