Labshake search
Citations for Roche :
2001 - 2050 of 6167 citations for 7 Bromo 1 methyl 1H indole 97% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... and 1× LightCycler 480 SYBR Green I Master (Roche) using a LightCycler 480 instrument (Roche ...
-
bioRxiv - Genomics 2021Quote: ... 1× cOmpleteTM protease inhibitor cocktail tablet (Roche Applied Science). The protein extracts were stored at −80 °C prior to the use in DNA-binding assays ...
-
bioRxiv - Genomics 2021Quote: ... 1 × cOmpleteTM protease inhibitor cocktail tablet (Roche Applied Science). The cells were disrupted by vortexing with glass-beads (0.45-0.5 mm in diameter ...
-
bioRxiv - Physiology 2020Quote: ... 1% NP-40) supplemented with protease inhibitors (Roche, Germany) and phosphatase inhibitors (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... levodopa (Madopar®, Roche, Levodopa/carbidopa, ratio 4:1) was administered twice daily for 4-5 months at an individually-tailored dose designed to produce a full reversal of the parkinsonian condition (p.o ...
-
bioRxiv - Plant Biology 2021Quote: ... 1× cOmplete mini EDTA-free protease inhibitor cocktail (Roche), 1% Nonidet P-40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 EDTA-free complete protease inhibitor tablet (Roche). The concentration of protein lysates was measure by Qubit assay (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% deoxycholate) and 5% protease inhibitor cocktail (Roche, Germany). Whole cell extracts were incubated at 4°C for 30 min on a shaker ...
-
bioRxiv - Neuroscience 2021Quote: ... After 1 hour in Western blocking reagent (Roche Diagnostics), membranes were incubated overnight with primary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM EDTA) supplemented with protease inhibitors (Roche, 11836170001). Protein concentration was determined by BCA assay (Pierce ...
-
bioRxiv - Cell Biology 2021Quote: ... wherein 1× KAPA HiFi HS Ready Mix (KAPA Biosystems) and 0.8 µM 1st PCR primer were included in a 25 μL reaction volume ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1:50 cOmplete proteinase inhibitor cocktail mix (Roche)) on ice for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (3F10; Roche Diagnostics, 1:1,000 dilution), mouse antiConnectin [C1.427 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM Na3VO4 and protease inhibitor cocktail (Roche, Germany). After centrifugation at 16,000xg for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... SYBR Green 1 Master (Cat# 4887352001, Roche Life science) was used to compare gene expression changes in VPRBP ...
-
bioRxiv - Immunology 2020Quote: ... 1 unit of AmpliTaq DNA polymerase (Roche Applied Science), 200 μM dNTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membranes were transferred onto 1× blocking buffer (Roche) and incubated at room temperature for 2-3 h ...
-
bioRxiv - Immunology 2021Quote: ... 20 µg.mL-1 of protease inhibitor cocktail (4693159001, Roche)] (10 mL per 1 L original culture) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were selected with 1 μg/ml Puromycin (Roche) and activated with IL-4 ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM PMSF and protease inhibitor mixture (Complete, Roche)) ...
-
bioRxiv - Immunology 2021Quote: ... and 30 U ml−1 DNase (Roche Diagnostics GmbH)) for 25 minutes in a shaking incubator at 37°C before being passed through a 100μm strainer followed by centrifugation at 300g for 5 mins ...
-
bioRxiv - Developmental Biology 2021Quote: ... sheep anti-digoxygenin-AP fab fragment 1:4000 (Roche). Alexa Fluor®-conjugated secondary antibodies were from Jackson Immuno Research ...
-
bioRxiv - Genomics 2021Quote: ... 1 U KAPA HiFi HotStart DNA Polymerase (KAPA Biosystems) in 1× HiFi Fidelity Buffer ...
-
bioRxiv - Genetics 2020Quote: ... 10 min DAPI staining (1:5000 in PBS; Roche) and 2 washes with 1xTBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM DTT) supplemented with protease inhibitors (cOmplete, Roche) and lysed by sonication ...
-
bioRxiv - Molecular Biology 2022Quote: ... rat-anti-HA (1:1000 for IB; Roche, ROAHAHA), rabbit anti-RECQL5 (1:1000 for IB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% NP40) supplemented with protease and phosphatase inhibitors (Roche). Equal amounts of cell lysates were incubated with anti-myc (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 500 mL) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 50 mL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 500 mL) ...
-
bioRxiv - Biophysics 2022Quote: ... 1× protease inhibitor cocktail (Roche, complete mini-EDTA free), and 1× phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5% NP40 (1 tablet of protease inhibitor (Roche, 11836170001) per 5 mL of buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 250 U mL-1 DNAse1 (#10104159001, Roche, Switzerland) in a buffer containing Hank’s Balanced Salt Solution (HBSS ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM PMSF and cOmplete protease inhibitor (Roche Diagnostics)) and lysed using glass beads [67] ...
-
bioRxiv - Cell Biology 2022Quote: ... Na Deoxycholate 1%) supplemented with protease inhibitor cocktail (Roche) and PMSF (1mM) ...
-
bioRxiv - Immunology 2022Quote: ... This cocktail contained Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Genomics 2022Quote: ... protease inhibitor (complete mini Roche, 1 tablet/10 ml). Cells were lysed at 4°C by repeated vigorous agitation with 0.5mm zirconia/silica beads in a bead beater (Biospec ...
-
bioRxiv - Genomics 2022Quote: ... 1 x EDTA-free protease inhibitor cocktail (cOmplete, Roche), 1 μg anti-Flag antibody (clone M2 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 cOmpleteTM EDTA-free protease inhibitor cocktail tablet (Roche) per 50 ml buffer) ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-α2δ-1 Abs (polyclonal, Roche, Cat # C5105) at 1:1000 or with mouse anti-GAPDH (1:25;000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1 cOmpleteTM Protease Inhibitor tablet (Roche, # SKU 11836170001). After homogenization ...
-
bioRxiv - Microbiology 2022Quote: ... containing 1 μL of Anti-digoxigenin-AP conjugate (Roche) at room temperature for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 U/ml dispase II (Roche Applied Science) in DMEM ...
-
bioRxiv - Systems Biology 2022Quote: ... pH 7.4) with 1 mg/ml collagenase B (Roche). We harvested the kidneys ...
-
bioRxiv - Systems Biology 2022Quote: ... and 1 % IGEPAL/NP-40 supplemented with PhosSTOP (Roche) and cOmplete ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25 or 0.17 mg ml−1 Liberase (Roche Diagnostics). The digested lungs were passed through a 1 ml syringe to make single-cell suspensions ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% NP-40 with protease and phosphatase inhibitors (Roche). DRG were further lysate by sonicated (Vibra-Cell™ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% Triton X-100 and protease inhibitor tablets (Roche)) supplemented with 0.5% SDS and 0.2% n-lauroylsarcosine and sonicated using a Bioruptor (Diagenode ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-DIG AP antibody (Roche, Bâle, Switzerland, 1:4000) was added in fresh blocking solution and incubated at 4 °C overnight ...