Labshake search
Citations for Roche :
1951 - 2000 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... anti-GFP (1:2000, mouse, Roche 1814460) and anti-Tubulin (1:1000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 1 mg/ml collagenase A (Roche) for 15 min at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mg/ml DNase I (Roche, 10104159001) and 0.5x Glutamax in 2 ml Hibernate A without calcium (BrainBits ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 150 mM NaCl, 2% w/v PVPP, 10 mM DTT, 1× tablet of cOmplete™, EDTA-free Protease Inhibitor Cocktail [Roche], 0.1% Tween 20 [Sigma] per 50 ml), centrifuged at 4200 × g at 4°C for 20–30 min ...
-
bioRxiv - Cell Biology 2020Quote: Cell lysis was carried out in MES-lysis buffer (50 mM MES/NaOH pH 6.5, 150 mM NaOH, 1% Triton, 1 mM EDTA, Complete EDTA free (Roche)) by beating using a Fast Prep 24 instrument (MP Biomedicals ...
-
bioRxiv - Cell Biology 2020Quote: ... was carried out using MES lysis buffer (50 mM MES/NaOH pH 6.5, 150 mM NaOH, 1% Triton, 1 mM EDTA, Complete EDTA free (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 mM NaCl; 1 mM EDTA, 1% Triton-X or 0.1% NP-40; supplemented with Complete Mini protease inhibitors, Roche). Cell lysates were cleared by centrifugation (3x 10 min at 20000 g at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the resulting crude synaptosome fraction was then resuspended in IP buffer (50 mM Tris pH 7,4; 100 mM NaCl; 1 mM EDTA, 1% Triton-X; supplemented with Complete Mini protease inhibitors, Roche) and cleared by 3x centrifugation at 20000 g ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% Triton X-100 and 0.1% SDS) with a protease inhibitor cocktail (Roche/1 tablet in 10 mL RIPA). Homogenates were centrifuged for 5 min at 4°C at 13,000 x G ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5% NP-40 and 1 mM EDTA supplemented with 1 × protease inhibitor complete mini EDTA-free cocktail from Roche). The supernatants of cell lysates were boiled for 5 min in 1 × SDS loading buffer (6 × ...
-
bioRxiv - Physiology 2020Quote: ... buffer (10 mM Tris [pH 7.5], 1 mM EDTA, 250 mM sucrose, 1 mM dithiothreitol [DTT], plus protease and phosphatase inhibitor cocktail [Roche]). Homogenates were centrifuged at 100,000 ×g for 1 h at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell pellets were resuspended and bead beaten in 250 μL urea buffer (6 M urea, 1% SDS, 50 mM Tris-HCl pH 6.8, 1 mM EDTA, 2x Roche protease inhibitors ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% v/v NP-40, 0.1% w/v SDS, 1% w/v sodium deoxycholate, 1× complete mini-protease mixture; Roche), and incubated on ice for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... pH = 7.6; 150 mM NaCl; 1 mM EDTA; 10% glycerol; 1% Nonidet P40 Substitute; protease inhibitor cocktail [Roche]; PhosSTOP [Roche]), using a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were treated with a commercially available collagenase/dispase mixture (1 mg·ml-1, 269638, Roche Diagnostics, Mannheim, Germany) and hyaluronidase (1 mg·ml-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.4) supplemented with 1 % Triton X-100 and protease inhibitor (Roche, 1 tablet per 100 ml lysis buffer) by gentle rocking at 4 °C for 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: VcanTg(Hoxa1)1Chm (Vcanhdf) mice [25] (Figure-1 Supplement 1) were obtained under a material transfer agreement from Roche. Generation of Has1−/−;Has3−/− double knockout mice was described previously [67] ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended with 1 mL lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl PH7.0, freshly added 1 mM PMSF, complete protease inhibitor [Roche]) for 10 min at 4°C and subjected to sonication to fragment the genomic DNA in size range of 300-700 base pair ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were then incubated in the blocking solution [1% Bovine Serum Albumin (Roche, Cat. No. 9048-49-1), 5% Normal Goat Serum (Thermoscientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 mM MgCl2, 10% glycerol, 300 mM NaCl, 0.2 U/mL DNase 1, 1 mM PMSF, complete proteinase inhibitor mixture; Roche) and homogenized with an EmulsiFlex for 20 min ...
-
bioRxiv - Biochemistry 2022Quote: ... the cells from each dish were then suspended in 300 μL of isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol) supplemented by 1 mg.mL-1 final lysozyme concentration and protease inhibitors (cOmplete, EDTA-free protease inhibitor cocktail, Roche). Clarified lysates were loaded onto a 5 mL HiTrap FF column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... The crude nuclei pellet was washed in 500 μL of isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche)) supplemented with 0.15% NP-40 ...
-
bioRxiv - Biochemistry 2022Quote: ... resuspended with precooled 1 mL isotonic sucrose buffer (290 mM sucrose, 10 mM imidazole, pH 7.0, 1 mM DTT, and 1 cOmplete protease inhibitor cocktail (Roche) per 10 mL buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... BRB80 buffer (80 mM Pipes pH 6.8, 1 mM MgCl2, 1 mM EGTA) supplemented with 1X protease inhibitors (Roche), and their ovaries were extracted with pre-cleaned forceps ...
-
bioRxiv - Cell Biology 2022Quote: ... A single-cell solution was obtained by tissue digestion using 1mgml−1 collagenase D and 0.1mgml−1 DNase I (Roche) in HBSS (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... Cells were spun down again and the pellet resuspended in 1.25 ml cold lysis buffer (PBS containing 1% TX-100, 1 mM NEM, and Complete Protease Inhibitor from Roche). Cells were lysed for 30 minutes on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... mitochondria were lysed in lysis buffer (50 mM Tris pH 7.4, 100 mM KCl, 1 mM EDTA, 1× Complete Protease Inhibitor cocktail (Roche), 1mM PMSF ...
-
bioRxiv - Microbiology 2022Quote: ... cells were lysed with lysis buffer (final concentration: 50 μg ml−1 lysozyme, 0.8% NP-40, 1 × protease inhibitor (Roche), 250 U ml−1 benzonase ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... cells were lysed with 100 µl Lysis buffer (10 mM Tris-HCl, pH 7.5, 300 mM NaCl, 1 mM EDTA, 1% Triton X-100, Protease Inhibitor Cocktail Roche). The cell pellet was resuspended by pipetting and incubated on ice for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 150 mM NaCl; 10 mM EDTA; 0.1% SDS; 1% Triton X-100; 1% deoxycholate; 1x complete protease inhibitor cocktail [Roche]), clarified and 20 μg total protein were used for SDS-PAGE followed by electroblotting ...
-
bioRxiv - Developmental Biology 2020Quote: ... Whole cells extract was isolated using RIPA buffer (NaCl 150mM – Tris HCL pH7,35 50mM – DOC 1% – N-P40 1% – H2O) supplemented with protease inhibitor (04 693 116 001, Roche). Isolated protein concentration was determined using Bradford assay (500-0006 ...
-
bioRxiv - Genomics 2022Quote: ... and incubated overnight with primary antibody in 3% BSA/TBS-T (monoclonal mouse anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG, RRID:AB_262044 or monoclonal mouse anti-GFP, 1:1,000, Roche #11814460001, RRID:AB_390913) at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... Lysates were prepared by resuspending cell pellets in 2 mL NP-40 buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 1 mM PMSF, 1x PhosSTOP [Roche]), sonication on ice (5s on/10s off for 2 mins at 40% amplitude) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The tissue was digested for 45-60’ at 37°C in a Thermomixer at 800 rpm in 1 mL of 1× PBS + 0.5 mM CaCl2 + 250 μg/mL Liberase (Roche) + 2 mg/mL of Collagenase (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse atria were minced and digested with mild agitation for 30 minutes at 37°C in DMEM containing 1% P/S and 0.14 Wunsch U ml-1 Liberase (5401119001, Roche). MAFs were enriched via negative selection with magnetic beads against mouse CD45 (leukocytes) ...
-
bioRxiv - Cell Biology 2023Quote: 12-16 hours old embryos were collected and lysed in homogenization buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and 1 tablet of proteinase inhibitor cocktail; Roche 11836170001). The aqueous phase of the lysate was collected after 1 hour of centrifugation at 4°C and centrifuged again for 25 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added to the indicated samples in Pull-down Buffer 1 containing 1% (w:v) BSA supplemented with cOmplete EDTA-free protease inhibitor cocktail (Roche) (final volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... then resuspended in cytoplasmic lysis buffer (25 mM Tris–HCl pH 7.5, 10 mM NaCl, 1.5 mM MgCl2, 1% IGEPAL CA-630, and 1× protease inhibitor cocktail [“PI”, Roche 11836170001]) at 4°C and incubated on ice for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 150 mM NaCl, 0.5% Triton X-100, 1 mM DTT, 150 μM ZnSO4, 1 mM PMSF, 1xEDTA-free protease inhibitors [Roche]) overnight on a rotating wheel at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Remaining red blood cells were resuspended in extraction buffer (50 mM Tris [pH8.0], 1 mM EDTA [pH8.0], 0.5% SDS and 1 mg / ml Proteinase K [Roche, Nutley, NJ]) and incubated overnight at 55°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... the sections were washed in a serial SSC buffer and formamide solution and then preincubated in buffer 1 (100 mM Tris-HCl, pH 7.5, 150 mM NaCl) with a 1% blocking reagent (Roche) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... they were incubated for 1 h at room temperature (20– 25 °C) in 0.1 M PBS with 1% blocking reagent (Roche) and 0.3% Tween 20 (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were harvested and washed thrice with FACS washing buffer (1X PBS + 1 mM EDTA, pH 7.2 + 1 Complete Inhibitor EDTA-free tablet (Roche) per 50 mL buffer) ...