Labshake search
Citations for Roche :
151 - 200 of 594 citations for Recombinant human IgE kappa L His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... or rat anti-HA-tag (Roche Diagnostics) or mouse anti-FlagM2 and rabbit anti-APP-CTF (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... HA-epitope-tag (Roche, rat, 1:100), Discs Large (DSHB ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-HA tag (Roche, RRID: AB_2314622), and rabbit anti-HA Tag (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-HA tag (Roche; RRID, AB_2314622), rabbit anti-HA Tag (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... mouse anti-HA tag (Roche, RRID: AB_2314622), rabbit anti-HA Tag (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2023Quote: ... Rat anti-HA tag (cat #11867423001, Roche), Sheep anti-PPM1H (DA018 ...
-
bioRxiv - Cell Biology 2020Quote: ... The region around the E-Box was amplified with primers outside of the homology regions using Kappa HiFi HotStart ReadyMix (Roche) and cloned into pCR-Blunt II-TOPO (Thermo Fisher) ...
-
bioRxiv - Genetics 2024Quote: ... In order to link the sequencing adaptors and double indexed libraries the second PCR step were performed using TG Nextera® XT Index Kit (FC-131-200(1,2,3) and the Kappa Hifi Hot Start (Roche KK2602) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... and amplified using KAPA Hi Fi polymerase (Roche) in 20 cycles of emulsion PCR35 (ePCR ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant IFN-α2a (Roferon L03AB04, Roche) and IFN-λ1 (Peprotech 300-02L ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then homology to the plasmid AatII site. Linear plasmids were amplified from circular plasmids (Fig. 2A) by two-step PCR using Kappa HiFi HotStart polymerase (Roche, Swtizerland). Cycling conditions were ...
-
bioRxiv - Immunology 2020Quote: ... First round of PCR amplification was performed using primers CGTTCAGAGTTCTACAGTCCGACGATCHHHHACHHHHACHHHNGCAGCCCATGGTACCA GCAGTTCC and ACTGGAGTTCCTTGGCACCCGAGAATTC using HotStart Kappa HIFI ready mix (Kapa Biosystems) and the following conditions ...
-
bioRxiv - Molecular Biology 2019Quote: ... HA and flag epitope tags (Roche and Sigma). Immunoreactive proteins were visualized with HRP-labeled secondary antibodies (Pierce ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-HA-tag antibody (mouse, 12CA5, Roche, 11583816001), Anti-Brn2 antibody (Rabbit ...
-
bioRxiv - Plant Biology 2021Quote: ... and quantified by RT-qPCR in a Bio-Rad CFX384 Touch detection system using the KAPPA KK4824 kit (Kapa Biosystems, Wilmington, USA). Two 150-bp single-end sequencing libraries were prepared using the NextSeq 500/550 High Output Kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we used Kapa Hi-Fidelity Library Amplification Kits (Roche) in 20 µL reactions with 4µL Nextera Unique Dual Indexes Set A (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was replaced with E6 medium (DMEM/F-12 supplemented with 64 mg/L L-ascorbic acid 2-phosphate magnesium, 14 µg/L sodium selenium, 543 mg/L sodium bicarbonate, mg/L insulin [Roche, Penzberg ...
-
bioRxiv - Immunology 2022Quote: ... DNAse I recombinant (Roche by Sigma Aldrich) and sodium pyruvate (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Immunology 2023Quote: ... 100 units/mL recombinant IL-2 (Roche), and 5 μg/mL PHA (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated overnight with rat anti-HA tag (Roche) and mouse anti-Actin (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... HA tag (Roche 11666606001, 1:1,000 or 1:3,000), His tag (Abcam ab18184 ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative Western blot analysis was employed to determine concentration of recombinant protein using a recombinant GFP standard (Roche, 11814524001) with a defined concentration of 1 mg/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... an anti-HA-tag antibody (#11867431001) was purchased from Roche, an anti-Flag-tag antibody (#012-22384 ...
-
bioRxiv - Cell Biology 2019Quote: ... rat anti-HA-tag mAb (clone 3F10, Roche, no. 11867423001), rabbit anti-SEC61A mAb (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... Ulp1 and cleaved affinity tag were removed by NiNTA (Roche). The NiNTA flow through was adjusted to 250mM NaCl and purified on HiTRAP-SP (20mM HEPES pH 7.3 ...
-
bioRxiv - Immunology 2021Quote: ... Quality of libraries were determined via Agilent 2200 TapeStation using High Sensitivity D1000 tape and quantified using Kappa SYBR®Fast qPCR kit (KAPA Biosystems, Inc, Wilmington, MA). Approximately 60-80 million paired-end 150 np sequence reads were generated per sample using the Ilumina HiSeq 4000 sequencer.
-
bioRxiv - Genomics 2022Quote: ... and amplified using KAPA Hi-Fi Hotstart PCR kit (Roche, KK2602). After one more step of DNA cleanup ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KAPA Hi-Fi HotStart ReadyMix (KAPA Biosystems) and libraries were purified with AMPure XP magnetic beads (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with recombinant DNASE I (1000 U) (Roche, 0453628001), cOmplete protease EDTA-free inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by the treatment with recombinant DNase I (Roche). 1 µg of the obtained RNA was used for cDNA synthesis using Superscript III (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin-2 (20U/ml; Hoffmann-La Roche). Fresh medium containing IL-2 was added twice per week ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Immunology 2023Quote: ... and 50 ng/mL recombinant DNase I (Roche Diagnostics) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNase I recombinant RNase free was purchased from Roche Life Sciences (Germany).
-
bioRxiv - Genomics 2022Quote: ... DNA libraries were amplified with KAPA 2× Hi-Fi Hotstart Readymix (Roche) and purified with 18% Sera-Mag Magnetic Beads in polyethylene glycol.
-
bioRxiv - Microbiology 2020Quote: ... His-tagged CopS(34-151) was purified using Ni-NTA columns (Roche)(11) ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged ecMSG was loaded onto a gravity nickel affinity column (Roche) and eluted using 300 mM imidazole ...
-
bioRxiv - Molecular Biology 2022Quote: ... Hi-C libraries were prepared using KAPA LTP Library Preparation Kit (Roche) 65 with 12 amplification cycles ...
-
bioRxiv - Physiology 2022Quote: ... 2 mmol/l MgCl2, 10 mmol/l NaF, 1 mmol/l PMSF, 1% Triton X-100 and Complete Protease inhibitor mixture, Roche Diagnostics) for 30 min on ice and centrifuged at 20,000 g for 10 min at 4ºC ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Molecular Biology 2021Quote: ... GFP and Myc-tag were detected using anti-GFP (Ref. 11814460001, Roche) and anti-Myc (either Ref ...
-
bioRxiv - Molecular Biology 2020Quote: Rat monoclonal anti-HA tag antibody (clone 3F10) was purchased from Roche LifeScience (Penzberg ...
-
bioRxiv - Biochemistry 2022Quote: ... Coverslips were incubated with HA-tag primary antibody (1:200, Roche, 11867423001) in 0.1% BSA in PBS for 1 hour before subsequent incubation with antirat Alexa Fluor 546 secondary antibody (1:400 ...
-
bioRxiv - Biochemistry 2023Quote: ... blotted onto a PVDF membrane and probed with α-HA tag (Roche, Catalog# 11867431001 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and DNA libraries were amplified with KAPA 2X Hi-Fi Hotstart Readymix (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... Full length cDNA amplification with Hi-Fi Hotstart Readymix (Roche, cat. no. 07959079001) was completed with a 98°C incubation then 21 cycles of (98°C for 15 sec ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...