Labshake search
Citations for Roche :
151 - 200 of 935 citations for Recombinant Mouse CD8a Antigen Alpha Chain His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 100 IU/ml of recombinant human IL-2 (Roche Diagnostics) or 10 μg/ml of SIVmac251 Env gp130 (ImmunoDx) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Bioengineering 2020Quote: Quantitative Polymerase Chain Reactions (qPCR) were prepared in 10μ reactions with SYBR Green I Master Mix (Roche), 1μL of genomic extract as a template ...
-
bioRxiv - Cell Biology 2019Quote: ... The COMMD1 sequence was amplified by polymerase chain reaction using the Pfu DNA polymerase (Roche, Basel, Switzerland), using an upstream primer to add a HindIII restriction site and retaining the SalI downstream of the coding sequence ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... The RBD fragment was amplified via polymerase chain reaction using Kapa HiFi HotStart ReadyMix (Roche, Basel, Switzerland) and then Gibson assembled in frame with an N-terminal His6-SUMO tag in the same vector as above ...
-
bioRxiv - Immunology 2021Quote: ... Real-time quantitative polymerase chain reaction (qPCR) was performed using SYBR green PCR master mix (Kapa biosystems), forward and reverse primers (200 nM) ...
-
bioRxiv - Microbiology 2023Quote: ... Polymerase Chain Reactions (PCR) were performed using KAPA HiFi HotStart Ready Mix® (KAPA biosystems, Boston, USA) with the following thermal parameters ...
-
bioRxiv - Biochemistry 2024Quote: ... excluding mitochondrial targeting sequence) were amplified by polymerase chain reaction (PCR) using Kapa HiFi Hotstart ReadyMix (Roche) and inserted into a pET-SUMO expression vector containing an N-terminal hexahistidine-SUMO tag (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and DNA libraries were amplified with KAPA 2X Hi-Fi Hotstart Readymix (Roche).
-
bioRxiv - Biophysics 2019Quote: ... the crude extracts mixed with cOmplete His-Tag purification resin (Roche, Basel, Switzerland) were loaded onto a polyprep chromatography column (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full length cDNA amplification with Hi-Fi Hotstart Readymix (Roche, cat. no. 07959079001) was completed with a 98°C incubation then 21 cycles of (98°C for 15 sec ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 µL of the Ni-NTA slurry (Roche cOmplete His-Tag purification resin) was washed with 2x1 mL of wash buffer (WB ...
-
bioRxiv - Molecular Biology 2023Quote: ... After gap repair with Kapa Hi-Fi HotStart Uracil+ DNA Polymerase (KAPA Biosystems) and Taq DNA Ligase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the supernatant was loaded into cOmplete™ His-Tag Purification Resin (Roche) pre-equilibrated with wash buffer ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... or zebrafish genomic DNA using the Expand Hi-Fidelity PCR System (11732641001, Roche). Exact coordinates are listed in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants after high-speed centrifugation were loaded onto His-Tag Purific Resin (Roche), washed and eluted with 50 mM Tris.HCl pH 7.5 ...
-
bioRxiv - Genomics 2024Quote: ... The cleared lysate was loaded onto a cOmplete His-tag purification column (Roche) and the His6-Sumo3-Tn5 was eluted with a running buffer containing 300 mM imidazole ...
-
bioRxiv - Molecular Biology 2023Quote: ... DIG-labeled TER and alpha-tubulin probes were generated using the PCR DIG Probe Synthesis Kit (Roche) and used in the hybridization step (S1 Table ...
-
bioRxiv - Genomics 2024Quote: ... The probe was labeled with alpha-32P CTP using the High Prime DNA labeling kit (Roche, #11585584001). The labelled probe was purified on a G50 sephadex column (Cytiva ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... HA-tagged proteins were detected and visualized using an HA antibody conjugated to HRP (Roche). For anti-HA immunoprecipitations ...
-
bioRxiv - Plant Biology 2021Quote: ... HA and GFP-tagged fusion proteins were detected using a Peroxidase-conjugated α-HA (Roche) or α-GFP (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Plant Biology 2022Quote: ... HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche) and anti-FLAG M2 (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: Antigen retrieval was conducted using a Tris based buffer-Cell Conditioning 1 (CC1)-Catalog # 950-124 (Roche). The SARS-CoV-2 spike primary antibody was of rabbit origin ...
-
bioRxiv - Immunology 2024Quote: Antigen retrieval was conducted using a Tris based buffer-Cell Conditioning 1 (CC1)-Catalog # 950-124 (Roche). The MHCII primary was of mouse origin ...
-
bioRxiv - Immunology 2021Quote: ... equal amounts of heavy- and light chain pDNA were mixed with X-tremeGENE HP DNA Transfection Reagent (Roche) in FreeStyle™ 293 Expression Medium (Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: Quantitative polymerase chain reaction (qPCR) was carried out using SYBR green mix buffer (Roche Applied Science, Meylan, France) in a LightCycler 480 Real-Time PCR System (Roche Applied Science ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative polymerase chain reaction (qPCR) analysis was conducted on Roche Light cycler®96 (Roche Diagnostics, Mannheim, Germany) and amplification curve was checked with ROCHE software version 1.1 ...
-
bioRxiv - Genetics 2022Quote: ... Quantitative polymerase chain reaction (qPCR) was performed using KAPA SYBR FAST qPCR Master Mix (KM4101, KAPA Biosystems, USA). The 2-ΔΔCT method was used for quantitative analysis ...
-
bioRxiv - Cancer Biology 2022Quote: ... Humanization of the heavy (Vh) and light (Vl) chains of the best two candidates was performed by Roche using proprietary technology ...
-
bioRxiv - Immunology 2020Quote: ... and IgA) primers were used to amplify VH-region sequences using polymerase chain reaction (PCR high fidelity, Roche); separate PCR reactions for each VH-family were performed to avoid cross-priming or primer competition ...
-
bioRxiv - Physiology 2022Quote: ... Quantitative real-time polymerase chain reaction (RT-PCR) was performed using SYBR Green protocols (Kapa Biosystems, MA, USA) on a real-time PCR detection system (Applied Biosystems 7300 Real-Time PCR system) ...
-
bioRxiv - Physiology 2023Quote: ... Real-time quantitative polymerase chain reaction (RT-qPCR) was carried out in a LightCycler 480 detection system (Roche) using the LightCycler FastStart DNA Master plus SYBR Green I kit (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Molecular Biology 2019Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) and incubated for 1 h at room temperature or 2 h at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) or Ni Sepharose High Performance (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... Fab was purified from cell culture supernatant by cOmplete His-Tag Purification Resin (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... His6-GFP and His6-mCherry proteins were purified with cOmplete His tag resin (Roche) according to the manufacturers protocols as previously described9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was added to cOmplete His-Tag Purification Resin (Merck Millipore/Roche) and incubated at 4°C for 1.5 h ...
-
bioRxiv - Genomics 2024Quote: ... the dialyzed sample was loaded again onto a cOmplete His-tag purification column (Roche), and the untagged Tn5 was collected in the flow-through ...