Labshake search
Citations for Roche :
151 - 200 of 3103 citations for R 4 Benzyl 2 2 diphenylphosphino benzyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 5 mg/ml 41,6-diamidino-2-phenylindole (DAPI; Roche, 1023627600) in PBS for 1 min and coverslips were mounted onto SuperFrost® Plus slides (R ...
-
bioRxiv - Immunology 2020Quote: ... About 2-5 μg of RNA were treated with DNAseI (Roche Diagnostics, Laval, QC) according to the product manual ...
-
bioRxiv - Immunology 2024Quote: ... 5% 2-ME) supplemented with protease and phosphatase inhibitor cocktails (#4693116001, #PHOSS-RO, Roche). A Pierce BCA Protein Assay Kit (#23225 ...
-
bioRxiv - Cell Biology 2024Quote: ... MCs were incubated with 160 µg/ml of BrdU (5-Brom-2′-desoxyuridin; Roche) for 2 h at 37°C and then washed with PBS and fixed with 4% PFA for 10 min at room temperature ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 ng was taken as a template for a PCR reaction (Supplementary Table 4, primers F: 42-65, R: 66-77) using KAPA HiFi HotStart ReadyMix (Roche, KK2602) for adding IIlumina indices and machine adapters ...
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Developmental Biology 2024Quote: ... Nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate substrate (NBT/BCIP substrate; Roche, Basel, Switzerland) was used for color detection ...
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... which then were transferred into 4-5 fold bigger volume of cOmpleteTM Protease Inhibitor Cocktail (Roche, Merck) in PBS and gently mixed for 30 minutes to aid HA dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% CHAPS (Roche), supplemented with 2 mM freshly prepared dithiothreitol ...
-
bioRxiv - Cancer Biology 2024Quote: ... (2) trastuzumab (Roche) treatment (10mg/kg ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.2 mM EDTA, 25% glycerol, 0.42 M NaCl, 2 mM beta-mercaptoethanol, 0.01% IGEPAL CA-630, 2× Roche cOmplete protease inhibitors ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 tetrazolium]-bis(4-methoxy-6-nitro)-benzene sulfonic acid hydrate (XTT)-based colorimetric assay (Roche) according to manufacturer-recommended protocols ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Biophysics 2020Quote: ... 5 mM MgCl2 (buffer B) containing 2 mM PMSF and Complete protease inhibitor cocktail (Roche). After centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM TCEP and 5 % glycerol) supplemented with cOmplete EDTA-free protease inhibitor complex (Roche) and ribonuclease A (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mg/mL DNAase (Roche, 04716728001). The cells were resuspended by mechanical agitation through Pasteur pipettes flamed with decreasing diameters ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Microbiology 2021Quote: ... employing 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and nitro blue tetrazolium (NBT) as substrates (RocheR, Roche Applied Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... the alkaline phosphatase activity was detected by using nitroblue tetrazolium chloride (337.5μg/ml) and 5-bromo-4-chloro-3-indolyl phosphate (175μg/ml) (Roche Diagnostics). Sections were mounted in Mowiol.
-
bioRxiv - Neuroscience 2020Quote: ... with 0.34 mg/ml nitroblue tetrazolium (NBT) and 0.35 mg/ml 5-bromo-4-chloro-3indolyl-phosphate (BCIP; Roche), for 1–12 hours at room temperature with gentle agitation ...
-
bioRxiv - Developmental Biology 2023Quote: ... Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µl cDNA and 5 µl of LightCycler 480 SYBR Green I Master mix (Roche Diagnostics GmbH, Germany). Three technical replicates of each sample were included ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Systems Biology 2023Quote: ... HepG2s were washed once with 1X PBS then lysed in SDS lysis buffer (50 mM Tris HCl/2% SDS/5% glycerol/5 mM EDTA/1mM NaF/dH2O) supplemented with cOmplete Protease Inhibitor Cocktail Tablets (Roche #11836170001), Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich® #P5726) ...
-
bioRxiv - Genomics 2024Quote: ... included 1.11 μM N7XX (5′-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG-3′) and S5XX (5′-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC-3′) primers (384PP_AQBP) in 2× HiFi HotStart ReadyMix (Roche, KK2602, 6RES_GPSA). Dual barcode sequences in primers are denoted by “XXXXXXXX.” Unique dual barcode combinations for each well of a 384-well plate were achieved by dispensing 16 unique N7XX barcodes across each row and 24 unique S5XX barcodes across each column ...
-
bioRxiv - Genetics 2023Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP-40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with protease inhibitor cocktail (Roche), as described previously (Kemaladewi et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM MgCl2, 2 mM DTT, 2 µM leupeptin, 2 mM PMSF, 250 mM sucrose, and 1× PhosSTOP phosphatase inhibitors [Roche]). The homogenate was centrifuged for 15 min at 10,000 × g at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 mM Tris(2-carboxyethyl)phosphine (TCEP) and cOmplete protease inhibitors (Roche). Cells were lysed by sonication and cell debris pelleted at 25,000 rpm for 40 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM Mg(OAc)2 supplemented with phosphatase and protease inhibitors (Roche) (adapted from (29)) ...
-
bioRxiv - Biophysics 2024Quote: ... 2 mg DNase (Roche) and 10 mM MgCl2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rinsed 2 times for 5 minutes with alkaline phosphatase buffer and stained with NBT/BCIP (Roche) as described previously (Kraus et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... the bill-skin preparation was treated for 5 minutes with 2 mg/mL collagenase P (Roche) in Krebs solution containing (in mM ...
-
bioRxiv - Biophysics 2022Quote: ... 2 mM β-ME) supplemented with 5 μM pepstatin A and complete protease inhibitor tablets (Roche). All purification steps were carried out at 4°C ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
Single-cell analysis of shared signatures and transcriptional diversity during zebrafish developmentbioRxiv - Developmental Biology 2023Quote: ... animals in PBST were rocked in 2% blocking buffer (5 g of blocking reagent, Roche, 11096176001) in 1X maleate buffer (150mM maleic acid ...