Labshake search
Citations for Roche :
151 - 200 of 944 citations for MMP 9 Mouse Monoclonal since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and the interaction between AtRsmD and the selected proteins was determined by immunoblot analysis with a mouse anti-GFP monoclonal antibody (1:5,000; Roche) and a mouse anti-Myc monoclonal antibody (1:10,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were incubated overnight at 4°C with monoclonal mouse anti-GFP antibody (Roche; Basel, CH; dilution 1:500) or monoclonal rat anti-HA antibody (Roche ...
-
bioRxiv - Genomics 2022Quote: ... and incubated overnight with primary antibody in 3% BSA/TBS-T (monoclonal mouse anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG, RRID:AB_262044 or monoclonal mouse anti-GFP, 1:1,000, Roche #11814460001, RRID:AB_390913) at 4°C ...
-
Brief Change in Dopamine Activity during Consolidation Impairs Long-Term Memory via Sleep DisruptionbioRxiv - Neuroscience 2023Quote: ... primary antibodies used to detect GRASP signals was mouse monoclonal anti-GFP (1:200, Cat# 11814460001, Roche Applied Science). Samples were then washed in PBS-T at 4 ℃ for 10 min for 3 times ...
-
bioRxiv - Cell Biology 2023Quote: ... target proteins were detected by using primary antibodies of mouse monoclonal anti-GFP antibody (1: 2000; Roche, Cat. 11814460001), mouse anti-mCherry (1:5000 ...
-
bioRxiv - Cell Biology 2022Quote: ... rat monoclonal (11867431001, Roche). Rabbit polyclonal antibodies specific for ZO-2 and ZO-1 ...
-
bioRxiv - Cell Biology 2020Quote: ... or X-Treme transgene 9 transfection reagent (Roche, Basel, Switzerland), according to manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected using X-tremeGENE 9 transfection reagent (Roche). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell line using X-tremeGENE 9 DNA transfection reagent (Roche). 48 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... using X-tremeGENE 9 DNA transfection reagent (Roche, cat# 6365779001) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and transfected 24 h later using Xtreme-GENE 9 (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded and transfected using XtrememGene 9 (Roche, USA) according to manufacturer’s manual 48 h prior to infection ...
-
bioRxiv - Cell Biology 2021Quote: ... pX330-based plasmids were transfected using X-tremeGENE-9 (Roche) together with a mCherry-expressing plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... containing AAVS1-targeting recombination arms [62] using XtremeGene 9 (Roche). Transfected cells were allowed to recover for 48 hrs before treatment with 1 μg/ml puromycin (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.4 µg vsFULL envelope plasmid using Xtremegene-9 (Roche). After 16 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Molecular Biology 2019Quote: ... eGFP-tagged readthrough reporter was immunoprecipitated by addition of 10 μg of mouse monoclonal anti-GFP IgG (Roche, cat#11814460001) or normal mouse IgG as a negative control (Proteintech ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysed cells were centrifuged for 15 minutes at 13000 rpm and then the supernatants were incubated mouse monoclonal anti-huntingtin antibody MAB2166 (MilliporeSigma) conjugated Protein G Agarose (Roche) at 4°C for 2 hours ...
-
bioRxiv - Plant Biology 2022Quote: GFP was detected on the membranes using anti-GFP mouse-IgG monoclonal (clones 7.1 and 13.1) antibody (Roche, Basel, Switzerland) in a 1/500 dilution in 5% (w/v ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-Green Fluorescent Protein overnight at 4°C (Clones 7.1 and 13.1; 1:50 dilution, Roche, Mannheim, Germany) and rat monoclonal anti-HA High Affinity for 60 minutes at room temperature (clone 3F10 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were in contact for 2 hours at room temperature with a mouse monoclonal primary antibody anti-BrdU (1/1000 dilution) (Roche), then rinsed and incubated for 30 min with a fluorescent secondary antibody Alexa-633nm goat anti-mouse (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were hybridised with monoclonal antibodies against GFP followed by anti-mouse alkaline-phosphatase conjugated antibody and signals were developed using NBT-BCIP (Roche).
-
bioRxiv - Plant Biology 2023Quote: ... membranes were blocked with 5% skim milk and then incubated in the primary anti-GFP mouse monoclonal antibody (Roche, 11814460001), followed by goat anti-mouse HRP conjugate (BioRad ...
-
bioRxiv - Physiology 2023Quote: ... co-staining for Cluster of Differentiation 15 (CD15) antigen was carried out using the CONFIRM Anti-CD15 Mouse Monoclonal Primary Antibody (Ventana/Roche; Roche Diagnostics ...
-
bioRxiv - Physiology 2023Quote: ... co-staining for Cluster of Differentiation 15 (CD15) antigen was carried out using the CONFIRM Anti-CD15 Mouse Monoclonal Primary Antibody (Ventana/Roche; Roche Diagnostics ...
-
bioRxiv - Plant Biology 2020Quote: ... by standard SDS-PAGE and detection by chemiluminescence with a monoclonal Anti-GFP antibody (Mouse IgG1K, clones 7.1 and 13.1, Roche Cat. No. 11814460001) and Anti-Mouse secondary antibody HRP-conjugated (Amersham ECL GE Cat ...
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche). To generate retroviral particles ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Biophysics 2021Quote: ... and cells were transfected using the Xtreme-Gene 9 reagent (Roche) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Cell Biology 2021Quote: ... rat monoclonal anti-HA (Roche), mouse anti-myc (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... monoclonal anti-GFP antibody (Roche) and polyclonal antibody raised against Erg6 (kind gift from G ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-HA (3F10, Roche), and monoclonal anti-tubulin (DM1A ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-GFP (Roche; monoclonal) antibodies were used to evaluate the abundance of PM H+-ATPase ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Dynabeads™ were washed once with 2 ml of PBS and coated with 15 μg of mouse monoclonal anti-GFP antibody (Roche Applied Science). The beads were finally washed three times with 2 ml of lysis buffer and added to the whole cell extract for a 2 h incubation with gentle rotation ...
-
bioRxiv - Neuroscience 2019Quote: ... The PVDF membranes were treated and immersed into the rabbit anti-mouse PSD-95 monoclonal antibody (1:1000, Roche Group, Nutley, USA) to incubate at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were incubated overnight at 4°C in Odyssey blocking buffer containing 0.1% Tween-20 at 4°C and 1/1000 dilution of anti-c-myc mouse monoclonal antibody (Catalogue number 11 667 149 007, Roche, Bâle, Switzerland) or anti-β-tubulin mouse antibody (Catalogue number T9026 ...