Labshake search
Citations for Roche :
151 - 200 of 1918 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... the AIRs were treated with 1 unit per AIR mg of type I α-amylase (Roche 10102814001, Roche GmbH, Germany). The de-starched AIRs ...
-
bioRxiv - Developmental Biology 2023Quote: ... dissected in ice-cold PBS and then digested with 4mg/ml Collagenase Type IV/ 0.2mg/ml DNase I /10% FCS/PBS under constant shaking with 700 rpm at 37°C for 12-15 min (Collagenase Type IV, Cat#: 17104-019, Gibco; DNase I, Cat#: 10104159001, Roche). Samples were filtered using a 70µm nylon filter and then washed twice with FACS buffer (0.5% FCS/2mM EDTA in PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... the AIRs were treated with 1 unit per AIR mg of type I α-amylase (Roche 10102814001, Roche GmbH, Germany). The de-starched AIRs ...
-
bioRxiv - Immunology 2023Quote: ... Lactate dehydrogenase (LDH) in the supernatants from either cell type was quantified using the LDH Cytotoxicity Detection kit (TaKaRa or Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche). Reverse transcription was performed as recommended by the suppliers ...
-
bioRxiv - Molecular Biology 2019Quote: ... 25 mM Tris-HCl pH 7.4, 5 mM EDTA, 5 mM MgCl2, 1% NP-40, 0.5 mM DTT, Roche mini-tablet protease inhibitor ...
-
bioRxiv - Immunology 2020Quote: Isolated B cells from Gal9KO mice were lysed in NP40 lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 5 mM dithiothreitol, 5 mM EDTA, 0.1% Nonidet-P40, Roche cOmplete mini EDTA-free protease inhibitor ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM NaF and protease inhibitors (Roche)] ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5 μL/mL NBT (Roche, 11383213001), was then added and slides were placed at 37°C to allow colour to develop ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol and protease inhibitor cocktail (Roche). The cell debris was removed from the lysate by centrifugation at 16,000 rpm for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... midazolam (5 mg/kg bodyweight; Dormicum, Roche), and medetomidine (0.5 mg/kg bodyweight ...
-
bioRxiv - Cell Biology 2021Quote: ... in 5 mg ml−1 dispase (Roche) and 0.1 mg ml−1 DNase I (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 μg of RNase A (Roche) per mg of cross-linked complex and incubated at 52 °C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μl of SybrGreen master mix (Roche) and 1 μl of water were processed in a LightCycler® 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% glycerol and 1x protease inhibitor (Roche)] ...
-
bioRxiv - Genetics 2024Quote: ... 5 μg/ml DNAse I (Roche 10104159001), and 0.05%Trypsin (Gibco 25200056 ...
-
bioRxiv - Cell Biology 2024Quote: ... and blocked in 5% BSA (Roche, 10735086001) in PBS solution ...
-
bioRxiv - Pathology 2020Quote: C-reactive protein was measured using the Tina-quant C-Reactive Protein Gen.3 reagent (Roche, Basel, Switzerland) designed to achieve very high sensitivity ...
-
bioRxiv - Molecular Biology 2019Quote: ... precleared with protein G-agarose beads (Roche), and incubated with anti-FLAG M2 agarose beads (Sigma #A2220) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the protein G agarose beads (Roche 11243233001) were prepared ...
-
bioRxiv - Plant Biology 2021Quote: ... proteins were cleaved by adding Trypsin (Roche) in a 1:100 trypsin:protein ratio ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.5 x protein inhibitors cocktail tablet (Roche), 2000 units of RNasin Plus ribonuclease inhibitor (Promega) ...
-
bioRxiv - Cancer Biology 2019Quote: ... was coupled to protein A beads (Roche). Immobilized antibody was incubated with peptide mixtures ...
-
bioRxiv - Cell Biology 2023Quote: ... 50 μl of Protein-A Agarose (Roche) were washed and equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins were transferred to PVDF membranes (Roche) in tris-glycine buffer using semi-dry transfer ...
-
bioRxiv - Cell Biology 2023Quote: ... 50 μl of Protein-A beads (Roche) was added to lysates and incubated with rotation for 2 h at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... HPV DNA capture was performed with NimbleGen’s SeqCap EZ Custom Library containing probes for all HR HPV types (Roche NimbleGen, Inc.,) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated in enzyme mix for tissue dissociation (collagenase type II enzyme mix (Gibco, 17101-015, 5mg/ml dissolved in Basis medium, DNase: 15ug/ml (Roche, 10104159001) and 10 μM Y-27632-HCl Rock inhibitor (Selleckchem ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated in enzyme mix for tissue dissociation (collagenase type II enzyme mix (Gibco, 17101-015, 5mg/ml dissolved in Basis medium, DNase: 15ug/ml (Roche, 10104159001) and 10 μM Y-27632-HCl Rock inhibitor (Selleckchem ...
-
bioRxiv - Genetics 2023Quote: ... We performed copy number qPCR using genomic DNA from three humanized and three wild type individuals using Light Cycler 480 SYBR Green I Master Mix (Roche #04707516001). The biological replicates for each individual were run in triplicate and error bars show the standard deviation from these technical replicates ...
-
bioRxiv - Physiology 2023Quote: ... Then the heart was perfused with the same solution containing 1 mg/mL collagenase Type A (Catalog # 9036-06-0; Roche, Germany) and 0.08 mg/mL protease Type XIV (Cat log # 48655321 ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein extracts were prepared by mechanical lysis using glass beads in presence of protein inhibitors (Complete EDTA-free, Roche) and 2x phosphatase inhibitors PhosStop (Roche) ...
-
bioRxiv - Plant Biology 2024Quote: ... and then total proteins were extracted and protein levels were determined by immunoblot analysis with anti-GFP antibody (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...