Labshake search
Citations for Roche :
151 - 200 of 820 citations for 6 Nitro 1H Indazole 3 Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 mM MES pH 6 plus protease inhibitor cocktail (Roche); lysates were centrifuged 10 min at 800xg ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized with random p(dN)6 primers (Roche) and MMLV reverse transcriptase (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... C-33A cells were transiently transfected using FuGENE 6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Digestion was performed with 6 units of MNase (Roche 10107921001) in 500 μl of a 20 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then with DAPI (4′,6-Diamidino-2-phenylindole, Roche) for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid transfections were carried out by FuGENE 6 (Roche, E269A) as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized with random primers p(dN)6 (Roche) using SuperScript III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 µl of MNase (1 mg/ml; Nuclease S7, Roche) was added to the lysate ...
-
bioRxiv - Cancer Biology 2023Quote: ... XG1 cells were supplemented with IL-6 (Roche, 3ng/ml).
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... and 0.2 μl of glucose-6-phosphate isomerase (PGI, Roche, #10127396001), while another 20 μl was incubated with 980 μl Glucose Reagent (Thermo Scientific ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Cell Biology 2020Quote: ... and Hexokinase + Glucose-6-Phosphate dehydrogenase at dilution 1:200 (Roche), for 15 min at 25°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Genomics 2021Quote: ... using 6 ml of FuGENE HD transfection reagent (Roche Diagnostic, USA) in 100ml of OPTIMEM medium (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: Cells were transfected with the appropriate plasmids using Fugene 6 (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and RCAS-Cre using a Fugene 6 transfection kit (Roche, 11814443001) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Cell Biology 2023Quote: ... with virus packaging and envelope expressing plasmids using Fugene-6 (Roche). Medium was replaced with DMEM with 10% FCS the next day and supernatant was harvested 3 days post-transfection ...
-
bioRxiv - Immunology 2023Quote: ... T237M or V1092A mutated hALPK1 cDNA constructs using FuGENE 6 (Roche).
-
bioRxiv - Immunology 2023Quote: ... samples were counterstained with 4’,6-Diamidino-2-phenylindol (DAPI, Roche).
-
bioRxiv - Molecular Biology 2024Quote: ... at a ratio of 6:1 using lipofectamine (Roche, catalog #6365787001), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... 5mM K4Fe(CN)6 and 1 mg/mL of X-gal (Roche) until precipitate was sufficient to visualize ...
-
bioRxiv - Developmental Biology 2020Quote: ... Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche) transfection reagent following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 μM EF-Tu was pre-incubated with 1 mM GTP (Roche) in Reaction Buffer for 5 minutes at 37°C and then was supplemented with 4 μM Val-tRNAVal (all final concentrations) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was stained for 6 min with 0.5 μg/ml DAPI (Roche) and coverslips mounted in Vectashield (Vector H-1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 % Igepal CA630) supplemented with 50 μl 6 x Complete (Roche, 04693132001) and 3 μl protease inhibitor (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with 4’,6-Diamidine-2’-phenylindole-dihydrochloride (DAPI; Roche).
-
bioRxiv - Cell Biology 2023Quote: U2OS cells were transfected with the indicated plasmids with Fugene 6 (Roche) according to manufacturer’s instructions using a 3:1 Fugene/plasmid ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...