Labshake search
Citations for Roche :
151 - 200 of 1947 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... The signals were detected by 4-nitro-blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Roche Diagnostics) in a humidified container for 12 h at 4°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Hmef1a_R_val1_193: 5′-CCGTTAAGGAGCTGCGTCG-3′), and KOD SYBR qPCR Mix (Toyobo, Osaka, Japan) in a LightCycler 96 system (Roche, Basel, Switzerland). The qPCR reaction was made with 5 µl KOD SYBR (TOYOBO) ...
-
bioRxiv - Bioengineering 2024Quote: ... in PBS (PBST) and then blocked for 3 hours at RT in PBS with 5 wt% bovine serum albumin (BSA, Roche), 5% goat serum (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... the slides were incubated for ∼72 hours at 37°C in staining solution containing nitro blue tetrazolium and 5- bromo-4-chloro-3-indolyl-phosphate (Roche). The slides were finally washed ...
-
bioRxiv - Genomics 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Cancer Biology 2024Quote: ... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... SE was stopped after 1H by two injections of Diazepam (Valium) with a 15 min interval (10 mg/kg, i.p. Roche, France). Pilocarpine-treated animals were then observed periodically for general behavior and occurrence of spontaneous seizures ...
-
bioRxiv - Cell Biology 2021Quote: ... for 1h at RT and incubated with a primary antibody diluted in blocking solution (sheep anti-digoxigenin, 1/200, Roche) overnight at +4°C in a dark humidified chamber ...
-
bioRxiv - Pathology 2020Quote: Lungs harvested and cut into small pieces were digested (1h, 37c) with 4 mg/ml collagenase D (Roche, Mannheim, Germany). Tissue was meshed through a 40-µm cell strainer ...
-
bioRxiv - Developmental Biology 2022Quote: ... bleached with 6% hydrogen peroxide in PBS for 1h and treated with 10 μg/ml Proteinase K (Roche, Mannheim, Germany) for 20 min (5 min for epithelia ...
-
bioRxiv - Developmental Biology 2024Quote: ... blocked in MAB-Buffer2 (20% sheep serum, MAB-Buffer1) for 1h and incubated with anti-DIG-AP antibody (1:4000, Roche) in MAB-Buffer2 overnight at 4 °C.
-
bioRxiv - Immunology 2022Quote: Mouse’s left lung was cut into pieces and digested for 1h with 10mL of DNAse I (10mg/mL, Roche #10104159001) and type I collagenase (100mg/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... Isolated tissue was cut in pieces of 2 cm and digested for 1h at 37°C in a HBSS solution containing 1% P/S and 2 U ml-1 Dispase II (Roche). Epidermal layer was separated from the dermis using two tweezers ...
-
bioRxiv - Immunology 2023Quote: ... fatty acid free (Roche, Basel, Switzerland), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and then the detection reaction was carried out in a buffer containing 3.5 µl/ml of of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Bâle, Switzerland). The reaction was stopped with 50 mM EDTA in PBS and embryos were washed in PBSTw ...
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were finally revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 ...
-
bioRxiv - Immunology 2022Quote: ... these tissues were dissected and incubated for 1h at 37ºC in the enzymatic cocktail containing Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: LC-MS-based quantification of methyl-cytosines was performed on 1 μg of DNA degraded to nucleosides with nuclease P1 (Roche), snake venom phosphodiesterase (Worthington ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1% deoxycholic acid and protease inhibitors (Roche), and thrice with lysis buffer without detergent ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.5% fatty acid-free BSA (Roche), 10 mg ml-1 Collagenase D (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.1% deoxycholic acid with protease inhibitors (Roche). The lysates were subject to anti-GFP immunoprecipitation using GFP-Trap beads or anti-Myc immunoprecipitation using Myc-Trap beads (ChromoTek) ...
-
bioRxiv - Plant Biology 2023Quote: ... ethylenediaminetetraacetic acid free protease inhibitor mixture (Roche) and phosphatase inhibitor mixture (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... These tissues were cut to ∼2mm pieces and incubated for 1h at 37ºC in the enzymatic cocktail containing Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... each fatty acid was first conjugated to 10% fatty-acid-free BSA (bovine serum albumin fraction V) (#10735086001, Roche) for 1 hour at 50°C in a 50:50 volumetric ratio ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from 253 resuspended vaginal swab samples using the MagNA Pure Compact Nucleic Acid Isolation Kit (Roche) [33] ...
-
bioRxiv - Biochemistry 2024Quote: ... The synergistic effect was determined based on the amount of acetic acid released using an acetic acid assay kit (Roche).
-
bioRxiv - Zoology 2024Quote: Virus nucleic acid was isolated using the Roche High Pure viral nucleic acid extraction kit (Roche Diagnostics GmbH, Manheim, Germany). The extraction process involved adding 200 μl of the working binding buffer (binding buffer mixed with poly[A] carrier RNA ...