Labshake search
Citations for Roche :
151 - 200 of 2356 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then washed 3 times for 5 min each in PBST and blocked with 1X Blocking Reagent (Roche) in PBST ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Microbiology 2024Quote: ... and 806R (5′-GGACTACNVGGGTWTCTAAT 3′) primers including the Illumina adapters and KAPA HiFi HotStart ReadyMix (Cat No.KR0370-v14.22; Roche, Switzerland) under the PCR cycle ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to the 3-4 ml of digestion media containing 0.1 mg/ml liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... They were then blocked in PBS with 3% BSA for 3h at RT and incubated overnight at 4°C with a peroxidase-labeled anti-DIG antibody (Roche) diluted 1:1500 in PBS with 3% BSA ...
-
bioRxiv - Cell Biology 2022Quote: ... Analysis was performed on either an LSRII 3 or 4-laser flow cytometer (Becton Dickinson) or Attune Acoustic Flow Cytometer (Roche). Post analysis was performed using either FACSDiva (BD) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was hybridized with a TAA(CCCTAA)4 probe which was conjugated with digoxigenin (DIG oligonucleotide 3⍰-end labelling kit, Roche) and signal was revealed using the anti-DIG-alkaline phosphatase antibodies (Roche ...
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Cell Biology 2024Quote: ... the digestion with 3 mg/mL type I collagenase was performed in parallel to and compared with 3 mg/mL type I collagenase + 4 mg/mL type II Dispase (Roche), 250 μg/mL Liberase DL (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
bioRxiv - Neuroscience 2020Quote: ... with 0.34 mg/ml nitroblue tetrazolium (NBT) and 0.35 mg/ml 5-bromo-4-chloro-3indolyl-phosphate (BCIP; Roche), for 1–12 hours at room temperature with gentle agitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µl cDNA and 5 µl of LightCycler 480 SYBR Green I Master mix (Roche Diagnostics GmbH, Germany). Three technical replicates of each sample were included ...
-
bioRxiv - Genomics 2020Quote: ... 60 μl of anti-mouse magnetic beads were washed PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche) or Anti-Rpb3 antibodies (Neoclone ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... Pellets were resuspended by bead beating for 5 min in 100 μL TE supplemented with 3 mM and 1x protease inhibitors (Roche) with 100 μL acid-washed glass beads ...
-
bioRxiv - Cell Biology 2022Quote: Sense and anti-sense DIG-labelled RNA probes were synthesised from 5’ and 3’ regions of tert using DIG RNA Labelling Mix (Roche). A 562bp 3’ region of tert ...
-
bioRxiv - Neuroscience 2022Quote: Mounted coronal cryosections were rinsed in PBS for 3 times (5 min) and thereafter incubated in Blocking Reagent (Roche Diagnostics) for 15 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was set by using qPCRBIO Probe Mix Hi-ROX (Nippongenetics) and TaqMan (5’: 6-FAM, 3’: TAMRA) or UPL (Universal Probe Library, Roche) probes ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate; Roche) until the staining appeared (overnight or up to 48 h) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting cDNAs were amplified with primers DP3 and DP5 (5’-GTTCAGAGTTCTACAGTCCGACGATC-3’, 0.5 μM) and KAPA Hifi HotStart DNA polymerase (Roche, KK2601) to the optimal amplification point ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 mM NaCl, 20 mM Imidazole pH 7.5, 3 mM MgCl2, 100 µM EDTA, 5 mM β-Mercapoethanol, 20 µM GDP, Roche cOmplete protease inhibitor cocktail and DNAse I ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Hmef1a_R_val1_193: 5′-CCGTTAAGGAGCTGCGTCG-3′), and KOD SYBR qPCR Mix (Toyobo, Osaka, Japan) in a LightCycler 96 system (Roche, Basel, Switzerland). The qPCR reaction was made with 5 µl KOD SYBR (TOYOBO) ...
-
bioRxiv - Bioengineering 2024Quote: ... in PBS (PBST) and then blocked for 3 hours at RT in PBS with 5 wt% bovine serum albumin (BSA, Roche), 5% goat serum (Gibco) ...
-
bioRxiv - Genomics 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... fatty acid free (Roche, Basel, Switzerland), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Neuroscience 2024Quote: ... specific digoxigenin (DIG)-labeled RNA probes and performed nitro blue tetrazolium (NBT)/ 5-bromo-4-chloro-3-indolyl-phosphate color-reaction (BCIP) after wash and incubation with anti-digoxigenin antibody (catalog. no. 11093274910; Roche; RRID: AB_514497) as previously reported (Zempo et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... fixed with 0.2% gluteraldehyde/4% PFA at room temperature and incubated overnight in hybridization buffer (5% Dextran sulphate, 2% blocking powder from Roche, 5X SSC ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Incubation of primary antibodies was performed overnight at 4 °C in 5% non-fat dry milk or 3.5% BSA (Roche, 10735086001). After three washes in PBS-T ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...