Labshake search
Citations for Roche :
151 - 200 of 3239 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Genetics 2021Quote: ... each sample was amplified in 6/2 PCR reactions (2 µg DNA/reaction) in the primary/secondary screens using the ReadyMix Kapa polymerase (Roche) with a total of 20 cycles and an annealing temperature of 55°C (Primer sequences in Table S4 ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole; 10236276001, Roche, Basel, Switzerland) for 5 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were labelled with 4’,6- Diamidin-2-phenylindol (DAPI, 1:1000, Roche Diagnostics GmbH ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma contamination was excluded by 4’,6-diamidino-2-phenylindole staining (Roche, Basel, Switzerland). Cell lines were authenticated by STR DNA profiling analysis (Leibniz Institute DMSZ ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Developmental Biology 2024Quote: ... knee cartilage was harvested from postnatal day 3-5 mice and treated with 3 mg/ml collagenase D (11088866001, Roche) in DMEM (10569010 ...
-
bioRxiv - Developmental Biology 2020Quote: ... the embryos were washed and equilibrated in NTMT buffer followed by coloration with 4-nitro blue tetrazolium (NBT, Roche) and 5-Bromo-4chloro-3-indolyl-phosphate ...
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2024Quote: ... 1µl each of 100 µM primers Sol-PrimerA (5′-GTTTCCCACTGGAGGATA-N9-3′) and Sol-PrimerB (5′-GTTTCCCACTGGAGGATA-3′) 18 and 0.8 µl Expand High Fidelity enzyme mix (Roche, Basel, Switzerland). Reaction conditions for the PCR were ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Neuroscience 2020Quote: ... sections are incubated with DAPI (4′,6-diamidino-2-phenylindole, Cat. no. 10236276001 Roche, Switzerland) for 10 minutes at room temperature ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellets were washed once with 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) (Roche, 10236276001) in methanol (1 μg/ml) ...
-
bioRxiv - Pathology 2024Quote: ... sections were incubated with 4′,6-diamidino-2-phenylindole (DAPI) (Roche Diagnostics GmbH, Mannheim, Germany) for 10 minutes to visualize cell nuclei ...
-
bioRxiv - Physiology 2023Quote: ... The signal was then visualized by incubating the slides for 48 hours in a solution containing 0.33 mg/mL NBT (Nitro-blue tetrazolium chloride, Roche, 11383213001) and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25% CHAPS, 5 mM ATP, 5 mM MgCl2, 0.25 mM EDTA, 2 mM DTT, 10% glycerol, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos were incubated in 1μg/ml of 4′,6-diamidino-2- 532 phenylindole (Roche, Cat# 10236276001) at RT for 10min and washed in PBS 1x ...
-
bioRxiv - Cell Biology 2022Quote: ... all sections were stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000) to visualize cell nuclei within the aortic tissue ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were labelled with 4’,6-Deamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000; Roche, #10236276001) for 20 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lumbar vertebrae 1 – 5 were incubated in 2% Collagenase P (Roche, Switzerland) for 30 minutes at 30° C ...
-
bioRxiv - Neuroscience 2020Quote: ... Then embryos were incubated for 2 hours in 5% Blocking Reagent (Roche) in MAB (150 mM maleic acid ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Cell Biology 2023Quote: ... all tissue sections were stained with DAPI (4′, 6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). For image generation an Axio Observer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Y-27632 was sourced from Selleckhem and 4’,6-diamidino-2-phenylindole (DAPI) was obtained from Roche. Colony formation assays were conducted with 2×103 cells in 6-well petri dishes subjected to treatments as indicated in the Fig ...
-
bioRxiv - Neuroscience 2021Quote: ... Glucose plasma concentration was measured with glucose oxidase method using 2’2-azino-bis (3-ethylbenzothialozine-6-sulfonate) (ABTS) (#10102946001, Roche, Germany) as substrate ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...
-
bioRxiv - Microbiology 2024Quote: ... spleens were collected from naïve C57BL/6 (CD45.1+) and a single cell suspension was obtained by incubation with Liberase Blendzyme 3 (Roche, Bradford, CT) and DNase (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Pathology 2023Quote: ... in HEK 293T cells (3×105 cells per well in 6-well plates) using X-treme gene transfection reagent (Roche). Pseudotyping was achieved by co-transfecting pHEF-VSVg (400 ng/well) ...