Labshake search
Citations for Roche :
1901 - 1950 of 1968 citations for IL 2 Rat HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were lysed by addition of 250 μl lysis buffer (50 mM Tris/HCl, 500 mM NaCl, 2% w/v SDS, add freshly 1 mM DTT, 1x Roche inhibitor cocktail) followed by incubation on ice for 10 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissue was sonicated in homogenization buffer (1% SDS, 50 mM Tris pH 7.4, 2 mM EDTA, protease and phosphatase inhibitors (Roche 11873580001; Roche 04906837001), heated at 95° C for 5 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Each reaction was then added to Strep-Tactin®XT 4Flow® high capacity resin (IBA # 2-5030-010) pre-equilibrated with XB buffer supplemented with cOmplete™ EDTA-free Protease Inhibitor tablets (Roche #11873580001) and/or PhosSTOP™ Phosphatase Inhibitor Tablets (Roche # 04906845001) ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole cell lysates were prepared by adding 1 volume of SDS lysis buffer (60 mM Tris-HCl pH 7.5, 2% SDS, 10% glycerol) supplemented with 1x protease inhibitor cocktail (Roche Diagnostics, Cat # 11836153001) and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Molecular Biology 2024Quote: ... twice with High Salt Wash Buffer (500 mM NaCl, 0.1 % SDS, 1 % Triton X-100, 2 mM EDTA, 20 mM Tris-HCl 8, 1x Roche protease inhibitor mixture), and twice with TE wash buffer (10 mM Tris-HCl pH 8 ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:50 in dH2O and mixed with an equal volume of target-specific primers and Roche 2×SYBR master mix (Roche, Cat No.04707516001). Plates were centrifuged at 1000 rpm for 1 min and stored at 4°C in the dark until ready for use ...
-
bioRxiv - Cell Biology 2020Quote: ... They were allowed to equilibrate in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 1 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) over night at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then incubated overnight at 4°C in primary antibody dilutions in freshly prepared BBT+ buffer (PBST + 1% BSA + 0.5 mM Spermidine + 2 mM EDTA + 1 large Roche complete EDTA-free tablets). Primary antibody was replaced with BBT+ buffer and quickly washed twice ...
-
bioRxiv - Developmental Biology 2022Quote: ... but with several differences from incubation with the anti-DIG antibody on: Incubation with blocking Buffer (2% Blocking Reagent from ROCHE in MABTween 1x) for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We induced transient expression of the plasmids in 106 cells resuspended in 2 ml using the polymer X-tremeGENE 9 DNA Transfection Reagent (Roche Applied Sciences 06365787001) following manufacturer’s instructions (1 μg total DNA and 3 μl reagent in 100 μl FBS-free culture medium) ...
-
bioRxiv - Genomics 2020Quote: ... SeqCap library preparation was performed using custom Nimblegen SeqCap probes (described above in §2.1) according to the NimbleGen SeqCap EZ HyperCap Workflow User’s Guide Ver 2 (Roche Sequencing Solutions, Inc., CA USA). Following capture ...
-
bioRxiv - Microbiology 2020Quote: Deidentified remnant patient samples that underwent routine clinical testing with the cobas SARS-CoV-2 assay on the 6800 platform (Roche Diagnostics, Indianapolis, IN) were used to evaluate the Xpert and ID Now assays ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Triton X-100, 150 mM NaCl, 10% glycerol, and 2 mM EDTA plus one Complete EDTA-free protease inhibitor tablet [Roche] per 50 ml) for 1 hr ...
-
bioRxiv - Biophysics 2020Quote: ... the same procedure was used using different lysis (50 mM HEPES pH 7.4, 100 mM NaCl, 10% glycerol, 1 mM DTT, 1 mM ATP, 2 mM PMSF, 1 Roche tablet per 50 mL) and storage (50 mM Tris pH 7.4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Cell Biology 2022Quote: ... triton X-100 in HBSS for 10 min and incubated with blocking solution containing 2% (w/v) bovine serum albumin fraction V (Roche, Woerden, The Netherlands) and 0.1% (v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... pellets were resuspended in lysis buffer (50 mM HEPES pH 8, 400 mM NaCl, 75 mM Imidazole pH 8, 5% v/v glycerol, 5 mM 2-Mercaptoethanol, supplemented with Roche Protease Inhibitor Tablets) and lysed using an Emulsiflex-05 homogenizer ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 μL of the diluted cDNAs and the KAPA SYBR ® FAST qPCR Kit Optimized for Light Cycler ® 480 (KAPA biosystems). Differences between samples and controls were calculated based on the 2−ΔCT method ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 12.5 ng of purified DNA from each sample was used as a template for PCR amplification in 25 μl reaction mixture by using 2 × KAPA HiFi Hot Start Ready Mix (Kapa Biosystems, MA, USA). For PCR amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed adding 2 μl of DNAse-treated RNA to 17 μl reaction mixture containing 1X Expand Reverse Transcriptase Buffer (Roche Diagnostics, Mannheim, Germany), 10mM of Dithiothreitol (DTT ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
bioRxiv - Physiology 2020Quote: ... finely cut with scissors and incubated in digestion medium (PBS with 2% BSA, 1M CaCl2, 94U/ml dispase II and 100mg/ml collagenase D, Roche Life Science, France) at 37°C for 30-40min ...
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates were extracted with phosphate-buffered saline (PBS) containing 2 % Triton X-100 and protease inhibitors (Roche Complete, Roche Diagnostics, Mannheim, Germany). Protein concentrations were determined by BCA-assay (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Microbiology 2023Quote: Capture-based libraries were prepared following the KAPA RNA HyperCap workflow with specific enrichment probes for SARS-CoV-2 (Roche Diagnostics, Mannheim, Germany). Each individual library was created using 10ul of extracted RNA input and following the protocol established by the kit’s manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... was performed in 2-day-old cells according to the manufacturer’s protocol (TMR red in situ cell death detection kit, Roche Diagnostics GmbH, Heidelberg, Germany) with modifications as described earlier (Smetana et al. ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Two mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland,05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Biochemistry 2024Quote: ... was washed once with 80 mL of lysis buffer 1 (20 mM Tris-HCl, pH 8.0) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...