Labshake search
Citations for Roche :
1901 - 1950 of 6054 citations for 7 METHYL 1 INDANONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM DTT) supplemented with protease inhibitors (cOmplete, Roche) and lysed by sonication ...
-
bioRxiv - Molecular Biology 2022Quote: ... rat-anti-HA (1:1000 for IB; Roche, ROAHAHA), rabbit anti-RECQL5 (1:1000 for IB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% NP40) supplemented with protease and phosphatase inhibitors (Roche). Equal amounts of cell lysates were incubated with anti-myc (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 500 mL) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 50 mL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 500 mL) ...
-
bioRxiv - Biophysics 2022Quote: ... 1× protease inhibitor cocktail (Roche, complete mini-EDTA free), and 1× phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5% NP40 (1 tablet of protease inhibitor (Roche, 11836170001) per 5 mL of buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 250 U mL-1 DNAse1 (#10104159001, Roche, Switzerland) in a buffer containing Hank’s Balanced Salt Solution (HBSS ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM PMSF and cOmplete protease inhibitor (Roche Diagnostics)) and lysed using glass beads [67] ...
-
bioRxiv - Cell Biology 2022Quote: ... Na Deoxycholate 1%) supplemented with protease inhibitor cocktail (Roche) and PMSF (1mM) ...
-
bioRxiv - Immunology 2022Quote: ... This cocktail contained Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Genomics 2022Quote: ... protease inhibitor (complete mini Roche, 1 tablet/10 ml). Cells were lysed at 4°C by repeated vigorous agitation with 0.5mm zirconia/silica beads in a bead beater (Biospec ...
-
bioRxiv - Genomics 2022Quote: ... 1 x EDTA-free protease inhibitor cocktail (cOmplete, Roche), 1 μg anti-Flag antibody (clone M2 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 cOmpleteTM EDTA-free protease inhibitor cocktail tablet (Roche) per 50 ml buffer) ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-α2δ-1 Abs (polyclonal, Roche, Cat # C5105) at 1:1000 or with mouse anti-GAPDH (1:25;000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1 cOmpleteTM Protease Inhibitor tablet (Roche, # SKU 11836170001). After homogenization ...
-
bioRxiv - Microbiology 2022Quote: ... containing 1 μL of Anti-digoxigenin-AP conjugate (Roche) at room temperature for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 U/ml dispase II (Roche Applied Science) in DMEM ...
-
bioRxiv - Systems Biology 2022Quote: ... pH 7.4) with 1 mg/ml collagenase B (Roche). We harvested the kidneys ...
-
bioRxiv - Systems Biology 2022Quote: ... and 1 % IGEPAL/NP-40 supplemented with PhosSTOP (Roche) and cOmplete ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25 or 0.17 mg ml−1 Liberase (Roche Diagnostics). The digested lungs were passed through a 1 ml syringe to make single-cell suspensions ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% NP-40 with protease and phosphatase inhibitors (Roche). DRG were further lysate by sonicated (Vibra-Cell™ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% Triton X-100 and protease inhibitor tablets (Roche)) supplemented with 0.5% SDS and 0.2% n-lauroylsarcosine and sonicated using a Bioruptor (Diagenode ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-DIG AP antibody (Roche, Bâle, Switzerland, 1:4000) was added in fresh blocking solution and incubated at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM Na3VO4) supplemented with complete protease inhibitors (Roche) and the collected supernatant was used for western blotting ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HA (rat monoclonal 3F10, Roche #11867431001, 1:5000), anti-TFR (monoclonal H68.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT and 1 × cOmplete protease inhibitors (Roche) and sonicated for 15 minutes total time (10s on/20s off ...
-
bioRxiv - Cancer Biology 2022Quote: ... and digested with 1 mg/ml collagenase D (Roche) and 100 µg/ml DNase I (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 tablet of Complete Mini EDTA-free (11836153001, Roche). The embryos in CDS were flash frozen in liquid nitrogen and samples were stored at -80 °C until they were genotyped and could be combined according to their genotype for further usage ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% Triton X-100) supplemented with protease inhibitors (Roche). Immunoprecipitation ...
-
bioRxiv - Immunology 2023Quote: ... and incubated with 1 mg/ml collagenase D (Roche) and 0.1 mg/ml DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... EDTA-free protease inhibitor pellet (1 capsule/ 50ml, Roche)) and lysed by a cell disruptor ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Neuroscience 2024Quote: ... protease inhibitor tablets (1 tbl/10 ml, #4693159001, Roche), AEBSF (1:100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... with antigen retrieval using Cell Conditioning 1 (CC1, Roche) for 48 minutes and primary antibody incubation for 60 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-HA (1:500; Roche, cat no:423001).
-
bioRxiv - Neuroscience 2024Quote: ... rehydration and permeabilization steps (1:3000 Proteinase K (Roche) in PBS-DEPC ...
-
bioRxiv - Neuroscience 2023Quote: ... sheep anti-Digoxigenin-POD (Roche Applied Science; 1:2,000), and sheep anti-Fluorescein-POD (Roche Applied Science ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1/5th volume of anti-GFP antibody (Roche) and 50μl of 0.1M Na-phosphate with gentle agitation for 30min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with collagenase D (1 mg/ml; Roche) in RPMI1640 medium at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:50 protease inhibitor (Complete Tablets EASYpack; 04693116001; Roche), 1:100 Phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 mM phenylmethylsulfonyl fluoride (PMSF) (Roche, Cat # 10837091001). The lysate was passed 10 times through a 25-gauge needle ...
-
bioRxiv - Cell Biology 2023Quote: ... and collagenase D (1 mg/mL; Roche, Basel, Switzerland) [9] ...
-
bioRxiv - Developmental Biology 2023Quote: ... Anti-Digoxigenin-POD Fab fragments (1:100) (Roche, 11207733910), and Goat α-mouse Alexa 488 (1:300 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and Complete protease inhibitor cocktail (Roche) at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and Complete protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Immunology 2023Quote: ... Dispase II (Roche; 1 mg/ml; cat. no. SCM133) and Dnase I (Sigma-Aldrich ...