Labshake search
Citations for Roche :
1901 - 1950 of 1954 citations for 7 Diethylamino 3 2 thienyl coumarin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Triton X-100, 150 mM NaCl, 10% glycerol, and 2 mM EDTA plus one Complete EDTA-free protease inhibitor tablet [Roche] per 50 ml) for 1 hr ...
-
bioRxiv - Biophysics 2020Quote: ... the same procedure was used using different lysis (50 mM HEPES pH 7.4, 100 mM NaCl, 10% glycerol, 1 mM DTT, 1 mM ATP, 2 mM PMSF, 1 Roche tablet per 50 mL) and storage (50 mM Tris pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... triton X-100 in HBSS for 10 min and incubated with blocking solution containing 2% (w/v) bovine serum albumin fraction V (Roche, Woerden, The Netherlands) and 0.1% (v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... pellets were resuspended in lysis buffer (50 mM HEPES pH 8, 400 mM NaCl, 75 mM Imidazole pH 8, 5% v/v glycerol, 5 mM 2-Mercaptoethanol, supplemented with Roche Protease Inhibitor Tablets) and lysed using an Emulsiflex-05 homogenizer ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 μL of the diluted cDNAs and the KAPA SYBR ® FAST qPCR Kit Optimized for Light Cycler ® 480 (KAPA biosystems). Differences between samples and controls were calculated based on the 2−ΔCT method ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 12.5 ng of purified DNA from each sample was used as a template for PCR amplification in 25 μl reaction mixture by using 2 × KAPA HiFi Hot Start Ready Mix (Kapa Biosystems, MA, USA). For PCR amplification ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed adding 2 μl of DNAse-treated RNA to 17 μl reaction mixture containing 1X Expand Reverse Transcriptase Buffer (Roche Diagnostics, Mannheim, Germany), 10mM of Dithiothreitol (DTT ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293 cells were transiently transfected with β-arrestin 2-Renilla luciferase 8 (Rluc8) and human C5aR2-Venus constructs using XTG9 (Roche, Sydney, Australia) for 24 h ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
bioRxiv - Physiology 2020Quote: ... finely cut with scissors and incubated in digestion medium (PBS with 2% BSA, 1M CaCl2, 94U/ml dispase II and 100mg/ml collagenase D, Roche Life Science, France) at 37°C for 30-40min ...
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates were extracted with phosphate-buffered saline (PBS) containing 2 % Triton X-100 and protease inhibitors (Roche Complete, Roche Diagnostics, Mannheim, Germany). Protein concentrations were determined by BCA-assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: Capture-based libraries were prepared following the KAPA RNA HyperCap workflow with specific enrichment probes for SARS-CoV-2 (Roche Diagnostics, Mannheim, Germany). Each individual library was created using 10ul of extracted RNA input and following the protocol established by the kit’s manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... was performed in 2-day-old cells according to the manufacturer’s protocol (TMR red in situ cell death detection kit, Roche Diagnostics GmbH, Heidelberg, Germany) with modifications as described earlier (Smetana et al. ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Two mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland,05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Biochemistry 2024Quote: ... was washed once with 80 mL of lysis buffer 1 (20 mM Tris-HCl, pH 8.0) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Genetics 2023Quote: ... 30 mM Tris-HCl, 20 mM KCl, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 150 mM NaCl, cOmplete proteinase inhibitor [Roche Diagnostics, Indianapolis, IN, USA]), lysed by ultrasonic treatment and incubated with EZview anti-HA agarose beads (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... a final concentration of 1 ng/μl cDNA was mixed with 2 μl FastStart DNA Master SYBR Green I (Roche #03 003 230 001), 0.5 μM forward and reverse primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 250 mg of powder was thawed at 4°C followed by resuspension in 1 mL of HIP buffer (40 mM HEPES-KOH pH 7.5, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween, 1x protease inhibitor cocktail [Roche], 1% solution P, 1 mM DTT). The lysate was next passed through a Whatman 25 mm GD/X Disposable filter (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed using the extracted DNA (100 ng) as template with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Plant Biology 2019Quote: ... the cDNA samples were diluted with 220 µl distilled water and 2 μl aliquots were amplified with the LightCycler® Nano Real-time PCR Detection System (Roche Applied Science, Tokyo, Japan) using the KOD SYBR® qRT-PCR Mix (TOYOBO) ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 mM NaCl, 1 mM MgCl2, 10 mM Imidazole, 0.5% IGEPAL® CA-630, 2 mM β-Mercapto-ethanol supplemented with Roche cOmplete inhibitor cocktail tablets) at a ratio of 15 ml of buffer/g of biomass ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were then thawed and resuspended in 1 ml lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 0.5 mg/ml lysozyme, 2 mM EDTA and one Roche protease inhibitor tablet per 10 ml). Complete lysis was achieved after a 15-min incubation at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5X SSC, 5X Denhardt’s solution, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water). Incubation with pre-hybridization buffer was carried out during 4h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50% formamide, 5X SSC, 5X Denhardt’s, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water) containing biotin and/or digoxin labeled Locked Nucleic Acid (LNATM ...
-
bioRxiv - Developmental Biology 2019Quote: ... 100 µl 10% SDS, 500 µl 20% N-Lavroyl sarsosine sodium, 2 tablets of cOmplete ULTRA Protease Inhibitor Cocktail [Roche Cat.# 05892970001] in 10ml FA buffer). The sample was then sonicated using a Covaris S220 at the following settings ...
-
bioRxiv - Developmental Biology 2022Quote: ... This was followed by a 2-hour incubation in an antibody mixture composed of a 1:1000 dilution of anti-digoxigenin-POD (Roche/Sigma-Aldrich, St. Louis, MO, USA) and a 1:500 dilution of anti-GFP antibody (ab6556 ...