Labshake search
Citations for Roche :
1901 - 1950 of 7278 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... in addition to qPCR on the Applied Biosystems QuantStudio 5 Real-Time PCR System using the Roche KAPA Library Quantification Kit (Roche, KK4824) to determine the concentration of adapter-ligated libraries ...
-
bioRxiv - Microbiology 2023Quote: ... beads with protein were subjected to overnight digestion by adding 100 µl 5 ng/µl sequencing grade trypsin (Roche Diagnostic GmbH) in ammonium bicarbonate (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... indexes and sequencing sequences) was performed on 5 µl of purified first step PCR products using Expand™ Long Template PCR System (Roche) with the following thermocycling program ...
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl from the partially amplified barcoded fragments was subjected to SYBR Green qPCR in a LightCycler 480 System (Roche, Germany) using the FastStart Essential DNA Green Master Mix (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were washed and lysed in 2 mL of lysis buffer (containing in mM: 50 Tris pH 7.2, 5 EDTA, 150 NaCl, 10 NEM, Protease Inhibitor Cocktail (Roche, Basel, Switzerland), 2 PMSF ...
-
bioRxiv - Molecular Biology 2024Quote: ... crosslinked chromatin was resuspended in 1 mL Farnham Lysis Buffer (FLB; 5 mM HEPES pH 8.0, 85 mM KCl, 0.5% NP-40/IGEPAL, Roche Protease Inhibitor Cocktail), centrifuged ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). The cell suspension was treated with a Sonopuls GM200 sonicator (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Microbiology 2024Quote: ... cDNAs were diluted to 1 ng/ µL and used for qPCR analysis in a 10 µL reaction mix containing 5 µL of LightCycler® 480 SYBR Green I Master mix (Roche), 300 nM of each primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Biochemistry 2023Quote: ... The S100 extract was eluted from DEAE resin with 5 ml of S100 Elution Buffer (250 mM KHPO4 (pH 6.5),1x Mini protease inhibitor cocktail tablet (Roche, Basel, Switzerland)) and aliquoted and flash-frozen in liquid nitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ng of DNA from each sample was analyzed using the Kapa Cyber Fast Q-PCR Kit (Kapa Biosystems, Wilmington, MA). The following rDNA primers (designed using Primer3Plus software ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The tissue was then washed with PBT extensively (10 times or more for 5 minutes) before development with BM-purple (1ml per well, Roche Diagnostics). Time of development was approximately 20 minutes at room temperature to 24 hours at 4°C depending on the probe ...
-
bioRxiv - Cell Biology 2022Quote: ... of siCon or siRictor NIH3T3 cells co-expressing Flag-NDRG1 WT were homogenized in 2% SDS + 5 mM DTT to retrieve proteins in solution supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 ml of digestion buffer containing collagenase D (2mg/ml, Roche #11088858001) and DNase (0.125 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue sections were equilibrated in hybridization solution (40 mL of prehybridization solution, 1.6 mL of 5 mg/mL, and 25 mg Roche yeast RNA) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... We equilibrated the sections in hybridization solution (50 mL of prehyb solution, 1.6 ml of 5 mg/ml, and 25 mg Roche yeast RNA) for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 min at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries were prepared from 700 ng DNA using the KAPA Hyper prep kit and unique dual-indexed adapters (5 µL of a 15 µM stock) according to the supplier’s protocol (Roche, Basel, Switzerland). The library concentration and size distribution were assessed on a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 mM KCl, 5 mM MgCl2, 0.05% NP-40, EDTA-free cOmplete mini protease inhibitor [Roche, 11836153001], PhosSTOP [Roche, PHOSS-RO]). If indicated ...
-
bioRxiv - Microbiology 2024Quote: ... Quantification of specific gene transcripts was achieved through droplet digital PCR (ddPCR) using the Digital LightCycler 5× RNA Master Kit (Roche, swiss) with specific primers and probes ...
-
bioRxiv - Microbiology 2024Quote: Probe was labeled according to the manufacturer instructions with TB40 SV40-GFP BAC DNA (Nick Translation Mix, Roche, 11745808910 and Tetramethyl-Rhodamine-5-dUTP, Roche 11534378910) and prepared for hybridization by combining 0.5mg of each labeled probe and 5mg cot-1 (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... Transcripts were amplified from 200 ng library product across 5 50-µL PCR reactions with 2x KAPA HiFi Master Mix (Roche, #07958935001), P065-P5 ...
-
bioRxiv - Microbiology 2024Quote: ... 50 µL of the post-nuclear supernatants was saved as the input lysate and 450 µL were incubated with 5 µg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Arterial samples to measure whole blood glucose concentrations were taken every 5-15 minutes and analysed using a handheld blood glucose meter (Accu-Chek® Aviva, Roche) to minimize blood volume sampling ...
-
bioRxiv - Physiology 2024Quote: ... for 45 s at 6,000 rpm×3 (and placed on ice for 5 min at the end of each 45 s homogenization) using a Roche MagNA Lyser instrument (Roche, Germany). RNA was extracted using standard Tri-Reagent procedure via chloroform/isopropanol extractions and 75% ethanol washing as per manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). Cells were lysed by sonication using a SonoplusGM200 (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pellets of CoREST and LSD1 were resuspended in lysis buffer (50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 5% glycerol, 7.5 mM imidazole supplemented with PMSF, DNAse and EDTA-free Roche protease inhibitor cocktail) in a weight ratio of 1:1.5 ...
-
bioRxiv - Systems Biology 2024Quote: ... equimolar amounts of oligo pool and reverse primer (Supplemental Table 5: Oligo Library cloning R: cttgctatgctgtttccagc) were mixed with 2X KAPA HiFi master mix (Roche, 07958935001) and incubated for 10 min at 72°C ...
-
bioRxiv - Neuroscience 2024Quote: Fresh frozen brains were weighed and homogenized with 4X w/v HSAIO buffer (50 mM Tris base, 274 mM NaCl, 5 mM KCl, pH 8.0) with protease (Pierce, cat# A32955) and phosphatase (Roche, cat# 04906845001) inhibitors using a motorized mortar and pestle ...
-
bioRxiv - Cell Biology 2024Quote: ... Programmed cell death was visualized with TUNEL assay according to manufacturer’s instructions for TUNEL TMR red kit (11767291910, 5% TUNEL enzyme; Roche Diagnostic Corp).
-
bioRxiv - Cell Biology 2024Quote: ... lysis buffer (50 mM Tris pH 7.5, 50 mM potassium acetate, 5 % v/v glycerol, 0.3 % v/v Triton X-100, Roche complete protease inhibitor)25,27,35 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 0.6 to 5 nanograms of enriched DNA was used for library preparation using the Kapa HyperPrep Kit (Roche, Cat. # 07962347001) following EpiCypher’s parameters for indexing PCR and library amplification as described in the CUT&RUN Library Prep Manual ...
-
GRASP55 Safeguards Proper Lysosome Function by Controlling Sorting of Lysosomal Enzymes at the GolgibioRxiv - Cell Biology 2024Quote: ... in TBS-T buffer [50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% Tween-20 (#A1389, AppliChem)] or with 5% BSA (#10735086001, Roche; #8076, Carl Roth) in TBS-T for phosphoprotein immunoblots ...
-
bioRxiv - Developmental Biology 2024Quote: ... and used in a 10 μL RT-qPCR reaction composed of 5 μL 2x KAPA SYBR FAST qPCR Master Mix (Roche, KK4600), 2.5 μL cDNA ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... 1% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA pH 8 and 1 tablet of protease inhibitor cocktail Roche cOmplete (Roche, Basel, Switzerland) and 1 tablet of phosphatase inhibitor PhosSTOP (Roche)) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with the primary antibodies diluted in blocking solution (H3K9me3: ab8898, 1:500, HP1α: CST #2616, 1:200, HA: Roche 3F10, 1:250) for 1h at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... the same procedure was used using different lysis (50 mM HEPES pH 7.4, 100 mM NaCl, 10% glycerol, 1 mM DTT, 1 mM ATP, 2 mM PMSF, 1 Roche tablet per 50 mL) and storage (50 mM Tris pH 7.4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates were prepared by incubating cells in RIPA lysis buffer (25 mM Tris pH 7.6, 150 mM NaCl, 1% NP40, 1% deoxycholate, 0.1% SDS, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF) on ice for 30 minutes and cell lysate was clarified by centrifugation at high speed (15 000 rpm ...
-
bioRxiv - Physiology 2022Quote: ... cell pellets were resuspended in RIPA Buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% IGEPAL CA-630, 1% deoxycholate, 1 mM DTT, DNase, and Roche cOmplete Protease Inhibitor Cocktail) and lysed via sonicating water bath ...
-
bioRxiv - Microbiology 2023Quote: ... 1% NP-40, 1 mM EDTA, 1 mM EGTA, 0.1% SDS, 1X EDTA-free protease inhibitor cocktail [#04693132001, Roche], and 0.5% sodium deoxycholate) and collected using a cell scraper ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.2% Triton X-100, 1 mM EDTA, 1 mM dithiothreitol, 1 mM NaF, 10 mM β-glycerophosphate, 0.1 mM Na3VO4, 1x Roche cOmplete protease inhibitors). Protein lysates (12 µg per lane ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were subsequently lysed (1 mM NaF, 1 mM Na3VO4, 10 nM calyculin A, 1 mM PMSF, 1 mg complete EDTA-free protease inhibitor cocktail [Roche] in RIPA buffer), scraped ...
-
bioRxiv - Biochemistry 2022Quote: ... 1% NP-40, 150 mM NaCl, 1 mM EDTA pH 8.0, 1 mM EGTA pH 8.0 and Roche complete protease inhibitor EDTA-free) and acid-washed glass beads using a Precellys machine (6 × 30 seconds ...
-
bioRxiv - Genetics 2022Quote: ... 5 mM EDTA. 0.2% Triton X-100, 1 mM PMSF, 1% Glycerol, 1 pellet/50 ml EDTA free Protease inhibitor [Roche] and 25 μM MG132). 100 μl diluted mixture was used as input ...
-
bioRxiv - Physiology 2020Quote: ... Proteins were extracted using 1:1 Pierce RIPA solution with protease inhibitor tablet (Roche). Samples were vortexed for 5 seconds ...
-
bioRxiv - Plant Biology 2021Quote: ... PMSF 1 mM and 1 protease inhibitor tablet (Roche cOmplete EDTA free cat# 05056489001)/50 ml) ...
-
bioRxiv - Microbiology 2020Quote: ... 1% Triton X-100) containing 1 tablet/50 ml of protease inhibitor cocktail (Roche), transferred to a tube and incubated for 15 min at 4°C on a wheel ...