Labshake search
Citations for Roche :
1901 - 1950 of 3510 citations for 4 Chloro 2 iodothieno 2 3 b pyridine 5 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Plant Biology 2024Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 10 mM DTT, 0.1% NP-40, and protease inhibitor cocktail [Roche]). Then ...
-
bioRxiv - Developmental Biology 2024Quote: ... animals were incubated in MABTw blocking solution (5% heat-inactivated horse serum, 5% Roche Western Blocking Buffer in MABTw) for 2 hours at room temperature and then incubated in anti-DIG-AP (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were lysed with 4% SDS lysis buffer (4% SDS, 150 mM NaCl, 50 mM triethanolamine pH 7.4, Roche protease inhibitor, benzonase). Protein concentrations were determined by the BCA assay (Pierce) ...
-
bioRxiv - Genomics 2024Quote: ... for which we could confirm their differential methylation between 4 Col-WT and 4 Col-ddm1 plants by comparing digested and non-digested samples using qPCR (Roche LightCycler 480). We then measured methylation states using this method on DNA extracted using Macherey-Nagel 96-well plate extraction kit (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 4 cOmplete EDTA-free Protease Inhibitor Cocktail tablets (Roche), 500 U benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... levodopa (Madopar®, Roche, Levodopa/carbidopa, ratio 4:1) was administered twice daily for 4-5 months at an individually-tailored dose designed to produce a full reversal of the parkinsonian condition (p.o ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 mL of Red Blood Cell Lysis Buffer (Roche) were added before being gently rocked for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... SDS 0.4%) + Proteinase-K 4 mg/ml (Roche, 3115887001) and incubated for 2h at 55°C ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x cOmplete® protease inhibitors (Roche) and 1.6 μL of 1 M DTT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x PhosStop® phosphatase inhibitors (Roche), 4 μL of 20x cOmplete® protease inhibitors (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... HindIII treatment was performed at 37°C for 1 h in 1x reaction buffer B with 10U of HindIII enzyme per reaction (HindIII, 10656321001, Roche, Switzerland). Mung bean nuclease treatment was performed at 30°C for 30 min in 1x mung bean nuclease reaction buffer with 1U per reaction (Mung Bean Nuclease ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Elecsys® Intact hCG+b electrochemiluminescence immunoassay (ECLIA) and the fully automated modular analytics E170 testing system from Roche Diagnostics (Mannheim ...
-
bioRxiv - Microbiology 2022Quote: ... incubated overnight at 32°C and replica-plated on a YES agar plate containing 100 mg/L hygromycin B (Roche, #10843555001). The hygromycin plates were incubated for 1-2 days at 32°C until colonies had formed ...
-
bioRxiv - Plant Biology 2024Quote: ... The transformation mixture was plated on TAP medium containing 18 μg/ml Hygromycin B (Roche 10 843 555 001; Mannheim, Germany) using 0.9% agar to screen for colony morphology ...
-
bioRxiv - Biochemistry 2023Quote: ... Selection for dominant markers was performed on YPD-based medium supplemented with 200 μg/mL G418 (Beyotime, ST081), 250 μg/mL clonNAT (KLBIOS, PD20181786) or 300 μg/mL hygromycin B (Roche, 10843555001).
-
bioRxiv - Physiology 2024Quote: ... TA muscles were dissociated and digested in DMEM F/12 medium containing 10 mg/ml of collagenase B and 2.4 U/ml Dispase (Roche Diagnostics GmBH) at 37°C for 30 min and passed through a 30 μm cell strainer ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA (1 μg) was mixed with 3 μl Fugene6 (Roche, #11836145001) in 200 μl opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche). After centrifugation at 400g for 5 min at 40C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % Triton-X and 5 % blocking reagent (Roche) and rabbit anti-GFP antibody (A11122 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Genetics 2020Quote: ... using 5 µL 2x KAPA mix (Roche, #KK2602), 10 µL cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 µg of RNase A (Roche Diagnostics) were added per µg of sample ...
-
bioRxiv - Physiology 2021Quote: ... midazolam (5 μg/g; Roche, Grenzach-Wyhlen, Germany) and fentanyl (0.05 μg/g ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μl phosphatase inhibitor 10X (Roche, 04906837001). Protein extracts from MCF10A-ER-Src were obtained by incubating cell pellets in Lysis Buffer SDS-Free containing 1% protease inhibitors and 1% phosphatase inhibitors on ice for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM DTT and proteinase inhibitor cocktail (Roche)) at 2ml/g ...
-
bioRxiv - Microbiology 2020Quote: ... 5% glycerol) containing protease inhibitors (Roche, Basel, Switzerland). Total cell lysates (25 μg ...