Labshake search
Citations for Roche :
1851 - 1900 of 7456 citations for 6 Chloro 1 phenylsulfonyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2021Quote: ... mitotic cells were obtained by mitotic shake-off and swelled in hypotonic buffer (75 mM KCl:0.8% NaCitrate:H2O at 1:1:1) with protease inhibitor cocktail (Roche) at room temperature for 10-15 min ...
-
bioRxiv - Microbiology 2020Quote: Whole cell lysates were generated by lysing cells in RIPA buffer (50 mM Tris-Cl [pH 7.4], 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1× Roche complete mini-protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2023Quote: ... pH 6.8, 10 mM DTT, 1 mM EDTA, 0.1% Tween, 1 mM PMSF, 1× Mini Protease Inhibitor Cocktail, Roche). The samples were centrifuged at 3000g for 6 min at 4°C using a tabletop centrifuge ...
-
bioRxiv - Genomics 2024Quote: ... 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% Sodium Deoxycholate, 0.1% SDS, 1× Protease Inhibitor cocktail, Roche) and incubated at 4 °C for 1 hour with rotation ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL trypsin solution (100 ng μL−1 Sequencing grade, Roche Deutschland Holding GmbH ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM phenylmethanesulfonyl fluoride (PMSF) and 1 X protease inhibitors (Roche)] ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% sodium deoxycholate and 1 × EDTA-free protease inhibitor cocktail (Roche) supplemented with Cycloheximide (100 μg/ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-HA (1:10,000; Pierce) or Anti-GFP (1:2000; Roche) served as primary Abs ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µg/ml aprotinin/pepstatin/leupeptin and 1 mM PefaBloc (Roche)) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM EDTA and 1 x cOmplete protease inhibitor cocktail (Roche) with three rounds of freezing in liquid nitrogen and rapid thawing ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-EM48 (1:500; Chemicon) or anti-HA (1:500; Roche) antibodies and developed with biotinylated secondary anti-rabbit (1:500 ...
-
bioRxiv - Physiology 2020Quote: ... digested for 1 hour with collagenase (Roche, 11088831001, 1 mg/ml) in RPMI medium at 37°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 mM DTT and 1 × EDTA-free protease inhibitor cocktail (Roche). Lysates were clarified by centrifugation at 17,000 ×g ...
-
bioRxiv - Plant Biology 2021Quote: ... 10% glycerol) containing 1 mM PMSF and 1× protease inhibitor (ROCHE) followed by incubation for 30 min at 4°C (shaking) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Roche #1814460001; WB 1:1000; IF 1:200), rabbit anti-FLAG (Cell Signaling Technology 2368 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mL human insulin (final concentration 20 μg mL-1, Roche), 1ml BSA (final concentration 50 μg mL-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% sarkosyl and protease inhibitor (1 tablet per 10 ml, Roche), and incubated for 60 min at room temperature ...
-
bioRxiv - Plant Biology 2023Quote: ... 1% Triton X-100,10% glycerol) containing 1× Protease Inhibitor Cocktail (Roche) and incubated for 30 min at 4℃ ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM PMSF and 1 x complete protease inhibitor cocktail (Roche). Immunoprecipitation experiments with GFP-trap beads were performed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... lysed by 1 mg mL-1 Collagenase-D (Roche, Basel, Switzerland) for 10 min ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT) supplemented with 1 complete protease inhibitor tablet (Roche). 40 mg/mL lysozyme was added to the pellets ...
-
bioRxiv - Molecular Biology 2019Quote: ... 14 ml lysis buffer (100 μg/ml Lysozyme, 1 % Triton, 1 mM PMSF, 1 x protease inhibitor (cOmplete, Roche), 10 mM DT ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibodies were diluted in blocking buffer and incubated at room temperature for 1 hour (Sigma Aldrich M2 Flag at 1:1,000; Invitrogen 22C5D8 Pgk1 at 1:6,000; Roche 12CA5 HA at 1:2,000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... were lysed in IP buffer (10 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM PMSF and Roche complete EDTA free protease inhibitor cocktail) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 25 mM KCl, 0.05 mM EDTA, 10% Glycerol, 1 mM DTT, 1 mM PMSF, 1× Complete Mini protease inhibitor, Roche) resuspended in RIPA buffer (150 mM NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and incubated in buffer A (50 mM MMT pH 8.0/300 mM KCl/10 mM MgCl2/5 % glycerol) containing 1 g L-1 lysozyme/2.5 U mL-1/SmDNAse//complete protease inhibitor cocktail (Roche) for 1 h prior to lysis using EmulsiFlex C5 (Avestin ...
-
bioRxiv - Cell Biology 2022Quote: ... The nuclei pellet was lysed in 400 μl RIPA buffer 1% SDS (1X PBS, 1% IGEPAL-C630, 0.5% sodium deoxycholate, 1% sodium dodecyl sulfate, protease inhibitor cocktail (Roche)) and incubated on ice for 10 min ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 mM protease inhibitor cocktail (1 mM EDTA, 20 mM NaF, 0.5% NP-40, 1% Triton X-100) (Roche) and 0.5% Na3VO4 on ice ...
-
bioRxiv - Microbiology 2021Quote: ... and LiCl (250 mM LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 20 mM Tris-HCl PH8.0, complete protease inhibitor [Roche]) washing buffers ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM Hepes pH 7.7, 1 mM MgCl2, 1 mM EGTA, 1% Triton TX100 supplemented with protease inhibitor cocktail, Roche). 20µl of HPC4 beads were supplied with 1mM Ca2+ ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM Hepes pH 7.7, 1 mM MgCl2, 1 mM EGTA, 1% Triton TX100 supplemented with protease inhibitor cocktail, Roche). Clarified extracts were incubated for 2 h with agarose beads previously coupled to 10 µg of non-immune rabbit IgG or 10 µg of affinity purified Arpin antibodies (according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM Hepes pH 7.7, 1 mM MgCl2, 1 mM EGTA, 1% Triton TX100 supplemented with protease inhibitor cocktail, Roche). Extracts were incubated with anti-GFP agarose beads (GFP-trap ...
-
bioRxiv - Neuroscience 2020Quote: ... γ at a 1:1:1 ratio) using retro-inverso dioleoylmelittin (riDOM) 0.2 mg/nl (synthesized at Hoffman-La Roche) and PEI 25 kD 0.67 mg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... 150 mM NaCl, 1 mM EDTA, 1% SDS, 0.1% Na deoxycholate, 1% Triton X-100, and 13 protease inhibitor cocktail [Roche]) was collected as nuclear proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... the nonspecific staining was blocked with 10% normal donkey serum in PBS with 1% BSA and 0.3% triton for 1 hour and then incubated with mouse anti-BrdU (1: 1000, Roche), rabbit anti-Ki67 (1 ...
-
bioRxiv - Plant Biology 2023Quote: ... Meristem-enriched samples or whole seedlings were ground in liquid nitrogen and homogenized in cold protein extraction buffer (50 mM Tris HCl pH 7.5, 10% glycerol, 1 mM DTT, 1% IGEPAL, 1× Roche EDTA-free protease inhibitor and 1× Roche phosphatase inhibitor) ...
-
bioRxiv - Immunology 2024Quote: ... beads and lysis buffer (20 mM Tris pH 7.4, 120 mM NaCl, 1 mM EDTA, 1% Triton-X-100, 0.5% sodium deoxycholate, 1× protease inhibitor cocktail [Roche])) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... 10 mM imidazole and 2 mM β-mercaptoethanol) supplemented with DNaseI (AppliChem) and Complete Protease inhibitor (Roche). After one passage through a French press cell ...
-
bioRxiv - Developmental Biology 2019Quote: ... slides were washed in 0.2x SSC then transferred to MBST before blocking with 2% blocking solution (Roche) for at least 1 hr at RT ...
-
bioRxiv - Cell Biology 2019Quote: ... samples were further incubated for 2 hrs in 40 µl pre-cleared protein-G agarose beads (Roche). Beads with immunocomplexes were centrifuged at 3,000 × g and washed four times in lysis buffer with intermittent incubations ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.05M Tris HCl pH 7.9, 5μM MgCl2, 5μM CaCl2, 2% SDS supplemented with 1x protease inhibitor cocktail, ROCHE) by sonication on ice ...