Labshake search
Citations for Roche :
1801 - 1850 of 5898 citations for Hydrotris pyrazol 1 ylborato trichlorotitanium IV since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Dispase II (Roche; 1 mg/ml; cat. no. SCM133) and Dnase I (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1× blocking reagent (Roche; 11096176001) for 2 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... and 1 tablet of protease inhibitor (EDTA free, Roche). Resuspended cells were subjected to Nitrogen cavitation (Simpson ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 μL WST-1 (Roche, Sigma-Aldrich, USA) for 1 hour at 37° C in a humidified incubator with 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-GFP antibody (1:200, Roche, # 11814460001, Germany), TRITC-conjugated goat anti-rat antibody (1:200 ...
-
bioRxiv - Microbiology 2023Quote: ... 1% NP-40 and 1x protease inhibitors (Roche # 4693159001), followed by centrifugation at 1000 x g at 4° C ...
-
bioRxiv - Microbiology 2023Quote: ... 1% DDM and EDTA-free protease inhibitor cocktails (ROCHE)) and incubated for 30min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... and 1:8000 secondary anti-DIG-PO antibodies (Roche) were added ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-DIG-POD (Roche Cat. N: 11207733910, 1:500) and Anti-FITC-POD (Roche Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mM NaF and protease inhibitor cocktail (Roche, 04693132001). After centrifuge at 4 ℃ ...
-
bioRxiv - Immunology 2023Quote: ... while stimulation with phytohemagglutinin (PHA, Roche, 1 μg/ml) was included as the positive control ...
-
bioRxiv - Microbiology 2023Quote: ... before application of Anti-His6-Peroxidase (Roche, 1:1000) in 5% (v/w ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 tablet of EDTA-free protease inhibitor tablet (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with DAPI solution (1:10, Roche). After washing ...
-
bioRxiv - Plant Biology 2023Quote: ... or GFP (diluted 1:1000, catalog no. 11814460001, Roche). Alkaline phosphatase conjugated anti-rabbit ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 tablet of complete protease inhibitor (Roche, 04693159001)] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 250 U/mL DNase 1 (#10104159001, Roche, Switzerland) in a buffer containing HBSS with Ca2+/Mg2+ (#14205-050 ...
-
bioRxiv - Immunology 2023Quote: ... then enzymatically dissociated (0.05mg ml-1 Liberase DL (Roche), 0.05 mg ml-1 Liberase TL (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM EDTA with protease and phosphatase inhibitors (Roche)) was added to dissected and snap-frozen tissues at a ratio of 6 μL/mg of tissue ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100) supplemented with protease inhibitors (Roche). Immunoprecipitation ...
-
bioRxiv - Genetics 2023Quote: ... 1 mM EDTA) with complete protease inhibitors (PI, Roche) at 4ºC for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 1× protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were obtained using the BCA Protein Assay Kit (Pierce ...
-
bioRxiv - Biochemistry 2023Quote: ... 1× cOmplete mini EDTA-free protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM DTT and Pierce® Protease Inhibitor (Roche). Thereafter ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 tablet “cOmplete” EDTA-free protease inhibitor (Roche) per 50 mL) ...
-
bioRxiv - Immunology 2023Quote: ... and collagenase D at 400 U ml-1 (Roche). After digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 x cOmplete protease inhibitor cocktail without EDTA (Roche), and 1 µM Cmd1 ...
-
bioRxiv - Genetics 2023Quote: ... 1:1000 anti-GFP antibody (Roche, # 11814460001, RRID: AB_390913) and 1:5000 goat anti-mouse IgG-HRP (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2023Quote: ... and labeled with anti-HA (1:1000, 1hr; Roche). HA-tagged CDPK1 in the cWT and cMut lines was visualized with secondary goat antibodies (1:2000 ...
-
bioRxiv - Genomics 2023Quote: ... protease inhibitors (1 tablet per 5 mL, Roche 4693159001)) was added to the embryo pellet ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25 or 0.17 mg ml−1 Liberase (Roche Diagnostics). The digested lungs were passed through a 1 ml syringe to make single-cell suspensions ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% NP-40 with protease and phosphatase inhibitors (Roche). DRG were further lysate by sonicated (Vibra-Cell™ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% Triton X-100 and protease inhibitor tablets (Roche)) supplemented with 0.5% SDS and 0.2% n-lauroylsarcosine and sonicated using a Bioruptor (Diagenode ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-DIG AP antibody (Roche, Bâle, Switzerland, 1:4000) was added in fresh blocking solution and incubated at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM Na3VO4) supplemented with complete protease inhibitors (Roche) and the collected supernatant was used for western blotting ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HA (rat monoclonal 3F10, Roche #11867431001, 1:5000), anti-TFR (monoclonal H68.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT and 1 × cOmplete protease inhibitors (Roche) and sonicated for 15 minutes total time (10s on/20s off ...
-
bioRxiv - Cancer Biology 2022Quote: ... and digested with 1 mg/ml collagenase D (Roche) and 100 µg/ml DNase I (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 tablet of Complete Mini EDTA-free (11836153001, Roche). The embryos in CDS were flash frozen in liquid nitrogen and samples were stored at -80 °C until they were genotyped and could be combined according to their genotype for further usage ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% Triton X-100) supplemented with protease inhibitors (Roche). Immunoprecipitation ...
-
bioRxiv - Immunology 2023Quote: ... and incubated with 1 mg/ml collagenase D (Roche) and 0.1 mg/ml DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... EDTA-free protease inhibitor pellet (1 capsule/ 50ml, Roche)) and lysed by a cell disruptor ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Neuroscience 2024Quote: ... protease inhibitor tablets (1 tbl/10 ml, #4693159001, Roche), AEBSF (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-HA (1:500; Roche, cat no:423001).
-
bioRxiv - Neuroscience 2024Quote: ... rehydration and permeabilization steps (1:3000 Proteinase K (Roche) in PBS-DEPC ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1/5th volume of anti-GFP antibody (Roche) and 50μl of 0.1M Na-phosphate with gentle agitation for 30min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with collagenase D (1 mg/ml; Roche) in RPMI1640 medium at 37 °C for 30 min ...