Labshake search
Citations for Roche :
1801 - 1850 of 7140 citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 25 ng of probe DNA was radioactively labelled with α– dCTP 32P using High Prime (Roche, 11 585 592 001), then hybridised to the membrane overnight at 65 °C in Church solution containing 10 μg/ml sonicated Herring Sperm DNA and 10 μg/ml tRNA ...
-
bioRxiv - Microbiology 2024Quote: ... BSA in TBST (TBSTB) and probed with rat monoclonal Anti-HAHA High Affinity antibody (clone 3F10, cat. no. 11867423001, Roche) diluted 1:1000 in TBSTB for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by an 8-minute perfusion with myocyte digestion buffer containing 5 mg of liberase dispase high DH enzyme (Roche) per digestion ...
-
bioRxiv - Genomics 2023Quote: ... The membrane was then extensively washed with low and high stringency buffers and subsequently blocked with buffer B2 (1% Blocking powder [Roche] in buffer B1 [100 mM Maleic acid ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were washed with high stringency (0.5× SSC, 70°C) and developed with alkaline phosphatase-conjugated anti-DIG antibody (Roche, Switzerland) with CDP-Star substrate in accordance with the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in PBS for 30 min and incubated overnight at 4°C with 1:1,500 anti-HA high affinity (Roche, 3F10). After three PBS washes ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR was performed in a 20 μL-volume system using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) according to Elaswad et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were amplified by ligation-mediated PCR for 6 cycles using a KAPA HiFi HotStart high-fidelity DNA polymerase (Roche) and purified using AMPure XP beads.
-
bioRxiv - Plant Biology 2024Quote: ... The immuno-complexes was then analysed on a 10% SDS-PAGE gel using immunoblotting methods with anti-HA antibodies (Anti-HA High Affinity Roche 3F/10 ...
-
bioRxiv - Plant Biology 2024Quote: ... and the immuno-complexes was then analysed on a 10% SDS-PAGE gel using immunoblotting methods with Abcam (Cambridge, UK) anti-GFP and anti-HA antibodies (Anti-HA High Affinity Roche 3F/10 ...
-
bioRxiv - Cell Biology 2024Quote: ... High-fidelity amplification of products and site-directed mutagenesis were performed with Kapa HiFi polymerase (Kapa Biosystems, Lab Supplies Scientific). Gene cassettes were generated by sequential cloning of the relevant fragments in the pGEM-T plasmid (Promega) ...
-
bioRxiv - Genomics 2022Quote: ... Positivity of SARS-CoV-2 infection was assessed both by PCR and measurement of specific antibodies (Cobas-Roche using Elecsys Anti-SARS-CoV-2 S). All patients gave their consent for participation in this study ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR reactions were set up using 96-well plates with FastStart Universal SYBR Green Master (Roche) and 1.5 µM primers (found in Table S2) ...
-
bioRxiv - Plant Biology 2020Quote: ... qPCR reactions were conducted on the LightCycler 480 Multiwell Plates 384-well themocycler (Roche Applied Sciences), with the following amplification program ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-PCR was performed using 96 well plates in a LightCycler® 480 Instrument by Roche. PCR reactions were performed using KAPA SYBR FAST qPCR Master Mix kit by Kapa Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR reactions were performed in LightCycler 480 96-well plates (Roche Diagnostics, Indianapolis, IN, USA) using a 10 minute pre-incubation period at 95°C followed by 40 cycles of denaturation for 5 seconds at 95°C ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR array were performed in 384-well plates on a LightCycler 480 instrument (Roche Applied Science). The reaction mix of 102 ul of sample cDNA was prepared using 2x SA Biosciences RT2 qPCR Master Mix and 10 ul of this mixture was added into each well of the PCR array ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gene expression was analyzed by quantitative PCR (qPCR) in 384-well plates using the LightCycler480 (Roche). For each tissue ...
-
bioRxiv - Microbiology 2024Quote: ... the master mix was added and the plate was placed in a LightCycler 480 II (Roche). The results were evaluated by Delta delta CT method considering the Cp values obtained from LightCycler 480 Software release 1.5.0 ...
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time quantitative PCR performed in duplicates in 384-well plates with a LightCycler 480 (Roche) using SYBR Green I Master (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR experiments were performed in a 384-well plate using LightCycler 480 SYBR Green (Roche; #4887352001) in a Roche LightCycler 480 II PCR system utilizing a Roche LightCycler 480 Software v1.5.1.62 ...
-
bioRxiv - Microbiology 2023Quote: ... at a 1:1 ratio in a 96-well deep-well extraction plate (Roche Diagnostics GmbH), covered with a MagNA Pure Sealing Foil (06241603001 ...
-
bioRxiv - Biochemistry 2023Quote: ... Denaturation assays were performed in a 384-well plate in a qPCR machine (Roche Lightcycler II) using a temperature range of 25-99 °C ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out in 12 μL volumes containing 6 μL of High Resolution Melting Master (Roche Applied Science, Germany), 0.24 μL of each 10 μM primer ...
-
bioRxiv - Plant Biology 2020Quote: ... transferred to a PVDF membrane and immunoblotted with rat monoclonal anti-HA (High Affinity, clone 3F10, Roche, www.roche.com; 1:2000 dilution) and hybridized with peroxidase conjugated goat anti-rat (Polyclonal ...
-
bioRxiv - Epidemiology 2019Quote: ... N-terminal pro-brain natriuretic peptide (NT-proBNP) and high-sensitive cardiac troponin T (hs-TnT) were determined on the same analyzer by immunoturbidimetry assays (Roche Diagnostics). Lipoprotein A-I (containing apoA-I but not apoA-II ...
-
bioRxiv - Zoology 2019Quote: ... 1 μg of total RNA was first retrotranscribed with primers supplied in the kit and this first-strand cDNA was used directly in PCR amplification reactions that were achieved using a high-fidelity enzyme (KAPA HiFi DNA Polymerase, Kapa Biosystems), the Universal Primer Short (UPS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and UCRS Fwd and SF Rev respectively (Table S1) in PCR reactions with either KAPA HiFi DNA polymerase with high GC buffers (KAPA Biosystems) or Hot FIREPol Blend Master mix (Solis BioDyne) ...
-
bioRxiv - Biochemistry 2019Quote: ... V187 were replaced by NNK codons in three rounds of inverse PCR using the Expand™ High Fidelity PCR System (Roche). One PCR reaction contained 1x Buffer 2 ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Immunology 2024Quote: ... reverse transcription was first carried out using High-Capacity RNA-to-cDNA and further quantified using Sybr Master mix I (Roche #04707516001). Relative gene expression over β-actin in cell lysates was calculated by the method while absolute N abundance in supernatants was quantified using the N normalizer plasmid.
-
bioRxiv - Neuroscience 2024Quote: ... using TGGAGCTGTTACCCACATCA and GCACAGTTCAGCGGGTACTT primers followed by a melting point analysis using the High Resolution Melting and Gene scanning application on the LightCycler 480 (Roche Diagnostics) was performed according to [3] ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2 supplemented with protease and phosphatase inhibitor cocktails (Roche)) for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 M NaCl with Complete protease inhibitor tablet (Roche, Indianapolis, IN) and centrifuged for 30 min at 13,000 rpm 4°C to pellet cell debris ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM EDTA) supplemented with EDTA-free protease inhibitor cocktail (Roche), phosphatase inhibitor (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Plant Biology 2019Quote: ... cOmplete mini protease inhibitor cocktail (2% v/v; Roche Molecular Biochemicals). Before NMR analysis D2O (5% to 10% v/v depending on frequency of spectrometer ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 2 mg/mL of collagenase A (Roche, Basel, Switzerland) and 1× DNase I (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% (v/v) 2-mercaptoethanol and 1× protease inhibitors (Roche; 11836170001). Insoluble material was removed by centrifuging at >12,000 × g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated in blocking buffer (2% blocking reagent (Roche, 11096176001) in 1x TNT ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was permeabilised in 2% Triton-X-100 (Roche, 40319421) in PBS and subsequently incubated in PBSGT blocking solution (0.2% gelatin ...
-
bioRxiv - Systems Biology 2021Quote: ... 2% fatty acid-free bovine serum albumin (BSA) fraction V (Roche), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich) ...