Labshake search
Citations for Roche :
1801 - 1850 of 8032 citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated at 55 °C overnight with 5 µL proteinase K (Roche). Genomic DNA was extracted with phenol:chloroform extraction.
-
bioRxiv - Molecular Biology 2020Quote: ... and supplemented with 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... in a total volume of 5 µL and analyzed on a Lightcycler 480 (Roche). Each reaction was done in three technical and three biological repeats ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA, mouse monoclonal primary antibody (12CA5 Roche, 5 mg/ml) at a dilution of 1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM β-mercaptoethanol and the EDTA-free complete ULTRA protease inhibitor cocktail (Roche). Proteins were batch-purified using Ni-NTA agarose resin (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... Mouse tail epidermis was separated from dermis by 5 mg/ml Dispase II (Roche) digestion in 37°C for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... 300 nM gene-specific primers and 5 µL SYBR Green Mix (Roche, Mannheim, Germany). Amplification was done using StepOneTM Real-Time PCR System according to the manufacturer’s description (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... supplemented with 5 mM DTT and a protease inhibitor cocktail (Complete EDTA-free, Roche). Spores were transferred to tubes containing Lysing Matrix E (MP Bio) ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μg of total RNA were treated with recombinant DNase I (Roche Diagnostics Ltd.) at 37°C for 30 min and then purified using a standard phenol–chloroform method ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% glycerol) supplemented with protease and phosphatase inhibitors (1X EDTA-Free inhibitor cocktail (Roche), 1 mM PMSF ...
-
bioRxiv - Physiology 2020Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Immunology 2019Quote: ... 150 mM NaCl] containing 5 mM EDTA and Complete EDTA-free protease inhibitor (Roche)) ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from lysed cells was removed using 5 μl RNAse-free DNAse I (Roche) for every 1 ml dissociate and incubated at 37°C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM EDTA and EDTA-free Protease Inhibitor Cocktail tablets (Roche AG, Basel, Switzerland). Cell debris was removed by centrifugation (4 °C) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of total RNA were treated with recombinant DNase I (Roche Diagnostics Ltd) at 37°C for 30 min and then purified using a standard phenol–chloroform method ...
-
bioRxiv - Genomics 2022Quote: ... We then added 5 μL of KAPA Unique Dual-Indexed Adapters (Roche, cat # 08861919702) diluted to 750 nM ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... containing 5% fetal bovine serum (FBS; ThermoTrace) and 0.6 μg/ml of Hygromycin (Roche) in a humidified incubator (37°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The 10 μl PCR mixture consisted of 5 μl KAPA2G Robust HotStart ReadyMix (Roche), 1 μl molecular grade water ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% nonfat dry milk and proteins detected using monoclonal anti-GFP (Roche), monoclonal anti-PGK (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 units of Micrococcal nuclease (Nuclease S7 Micrococcal Nuclease, cat# 10107921001; Roche Applied Science) with 200 units ExoIII (cat# M0206S ...
-
bioRxiv - Microbiology 2023Quote: ... 5% Glycerol) complemented with lysozyme (0.25 mg/ml; Merk) and cOmplete Protease Inhibitor (Roche). The samples were sonicated and centrifuged at 15,000g for 45 min at 4°C to pellet cell debris ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM EDTA) supplemented with a protease inhibitor cocktail (Complete, Roche Applied Science, #11836153001) and phosphatase inhibitors (PhosSTOP Sigma #04906837001) ...
-
bioRxiv - Systems Biology 2024Quote: ... 5 mM EDTA and 0.5% Triton X-100 containing cOmplete Mini protease inhibitor (Roche) via 3 rounds of probe ultrasonication ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mg/mL DNaseI (Gold Biochem) and a single “Complete” protease inhibitor tablet (Roche). Cells were lysed by sonication and the lysate clarified by centrifugation and applied to glutathione agarose (1 mL bed volume ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 5 µl of X-tremeGENE 9 transfection reagent (XTG9-RO Roche, Sigma-Aldrich). Three days after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems, Wilmington, MA), 0.3 mM of each primer and 1 µL of DNA template (20 ng µL-1) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... for 5 minutes on ice and re-suspended in DPBS with Protectorase (Roche #3335402001) and Superase (Invitrogen #AM2694 ...
-
The derlin Dfm1 promotes retrotranslocation of folded protein domains from the endoplasmic reticulumbioRxiv - Cell Biology 2020Quote: ... 2 mM benzamidine and cOmplete protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany)) and incubated with zymolyase 20T for ∼20min at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... resuspended in protein resuspension buffer (2% SDS, 10 mM NaF, 1x Roche cOmplete Mini proteinase inhibitor cocktail ...
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Tris(2-carboxyethyl)phosphine) supplemented with phosphatase inhibitor cocktail (Roche) followed by heating to 100°C for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... the nuclei were stained with PBS containing 2 μg/ml DAPI (Roche) for 10 minutes at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM MgCl2) supplemented with a cOmplete Protease Inhibitor Cocktail (Roche Diagnostics) and 1500 units Benzonase (Millipore Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM β-mercaptoethanol and cOmplete™ ETDA-free protease inhibitors (Roche)) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM β-mercaptoethanol and cOmplete™ ETDA-free protease inhibitors (Roche)).
-
bioRxiv - Microbiology 2021Quote: ... 0.5% NP-40) with 2 mM PMSF and proteinase inhibitor cocktail (Roche). The supernatant lysates were then incubated with anti-GFP agarose (KTSM1301 ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4’6-diamidino-2-phenylindole (DAPI) (Roche, Basilea, Switzerland) and slides were mounted with Fluorsave (Merck) ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 mM EDTA) supplemented with a complete protease-inhibitor cocktail (Roche; 11697498001) and disrupted by vortexing with acid-washed glass beads ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mg/ml lysozyme (Roche, ref. no. 10 837 059 001) and sonicated six times for 30 seconds ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mM EGTA) supplemented with protease inhibitors (Complete Mini, Roche, Basel, Switzerland). After clearing (15000×g for 15 min) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mM EDTA and cOmpleteTM EDTA-free Protease Inhibitor Cocktail (Roche, USA). The homogenized samples were centrifuged at 700 g for 10 min to obtain the post-nuclear supernatant (PNS) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1mM EDTA) supplemented with 2× EDTA-free Complete Protease Inhibitor Cocktail (Roche). Protein lysates were collected from supernatant after centrifugation at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM MgCl2] supplemented with cOmplete Protease Inhibitor Cocktail (Roche, Basel, Switzerland). After 15 min of incubation on ice ...
-
bioRxiv - Plant Biology 2021Quote: ... 2% β-mercaptoethanol) and cOmplete EDTA-free protease inhibitor cocktail (#04693159001, Roche). Water- saturated and Tris-buffered phenol (pH 8 ...