Labshake search
Citations for Roche :
1751 - 1800 of 4837 citations for Cow Bile Salt Activated Lipase CEL ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: Libraries are quantified via qPCR using the KAPA Library Quantification Kit (Roche 0796020400), which specifically analyzes sequencing-competent fragments ...
-
bioRxiv - Genomics 2022Quote: BANC-seq libraries were prepared using the Kapa Hyper Prep Kit (Kapa Biosystems) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was done with the SYBR Green I Master kit (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... LDH release levels were analyzed using a Cytotoxicity Detection Kit (Roche, Basel, Switzerland). Purified Ply(1μM)was co-cultured with various concentrations of alnustone at 37°C for 30min ...
-
bioRxiv - Microbiology 2022Quote: ... The KAPA HiFi Hot Start Ready Mix kit (Kapa Biosystems, Woburn, MA, USA) was used for PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Microbiology 2022Quote: ... JE1 amylase activities were measured in culture supernatants using the AMYL kit (Roche/Hitachi #11876473 001 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was generated by using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed using FastStart SYBR green master mix (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA libraries were prepared with KAPA RNA Hyaperprep kit KR1350 – v2.17 (Roche). Data quality was checked by Fastqc v0.11.8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Pathology 2022Quote: ... and quantified using the KAPA Library quantification kit for Illumina platforms (KAPA Biosystems). One hundred base pair single-read sequencing of multiplexed samples was performed on an Illumina HiSeq 4000 sequencer ...
-
bioRxiv - Plant Biology 2022Quote: ... The library was quantified with the KAPA Library Quantification Kit (Roche, Basel, Switzerland), and the fragment size of the library was verified using an Agilent Technology 2100 bioanalyzer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mRNA was isolated with an mRNA Isolation Kit (Roche, # 11 741 985 001) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the LightCycler Fast Start DNA Master SYBR Green I kit (Roche Diagnostics) as previously described (Maire et al. ...
-
bioRxiv - Microbiology 2022Quote: ... LDH in the cell supernatants was quantified using the Cytotoxicity Detection kit (Roche), following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The libraries were constructed using the KAPA HyperPlus Library Preparation Kit (KAPA Biosystems) and sequenced using the Illumina HiSeq 4000 platform (with 150 bp paired-end reads) ...
-
bioRxiv - Microbiology 2023Quote: ... with a KABA SYBR Fast Universal qPCR Kit (Kapa Biosystems, Wilmington, MA, USA) was used for quantification ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were quantified using the KAPA qPCR quantification kit (KAPA Biosystems, Wilmington, MA) and sequenced on an Illumina HiSeq 2500 producing single end 50 base pair reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the LightCycler FastStart DNA Master SYBR Green I kit (Roche Diagnostics, 03003230001). The amplification condition for Oct3/4 was 10 min at 95ºC for one cycle ...
-
bioRxiv - Microbiology 2022Quote: ... using commercial kits adapted for a COBAS 6000 autoanalyzer (Roche Diagnostics, Rotkreuz, Switzerland). Radiolabeled HDLs were prepared as previously described24 ...
-
bioRxiv - Microbiology 2022Quote: ... the cell viability was assessed by using the XTT kit (Roche Applied Science) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Hybridization reactions were washed using SeqCap Hybridization and Wash Kit (Roche, Cat#: 05634261001) and DNA eluted in 50μL molecular grade water ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA extraction was performed by using the HighPure FFPET RNA extraction kit (Roche). RNA concentration and quality were assessed on the Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2022Quote: ... DNA libraries were quantified via qPCR using a KAPA Library Quantification kit (Roche Sequencing and Life Science ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted using the HighPure RNA Isolation kit (Roche, Mannheim, Germany; # 11828665001) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quantification was done using the KAPA quantification kit (Kapa Biosystems, Wilmington, MA). Sequencing was accomplished using HiSeq 2500 technology (Illumina SBS kit v4 ...
-
bioRxiv - Neuroscience 2023Quote: ... the Ultra View Universal 3,3’-Diaminobenzidine (DAB) Detection Kit (760-500, Ventana, Roche) was used ...
-
bioRxiv - Pathology 2023Quote: ... Signal was detected using Fast Red detection kit (8127166001, Roche Diagnostics, Penzberg, Germany).
-
bioRxiv - Microbiology 2023Quote: ... shotgun genomic libraries were prepared with the Hyper Library construction kit (Kapa Biosystems) and sequenced on an Illumina HiSeq 4000 (150 bp x 2 mode).
-
bioRxiv - Microbiology 2023Quote: ... and PCR products were purified using the DNeasy blood and tissue kit (Roche), the High Pure Plasmid Isolation kit (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... and plasmid DNA was isolated using a High Pure Plasmid Isolation Kit (Roche). For amplification of genetic elements ...
-
bioRxiv - Genomics 2023Quote: Total RNA libraries were prepared using the KAPA mRNA HyperPrep Kit (Roche Diagnostics) following the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... D1000 tape and quantified using an NGS library quantification kit (Roche/Kapa Biosystems) on a StepOnePlus real time PCR workstation (Thermo/ABI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... D1000 tape and quantified using an NGS library quantification kit (Roche/Kapa Biosystems) on a StepOnePlus real time PCR workstation (Thermo/ABI) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified and assessed using the Kapa Library Quantification Kit (Kapa Biosystems) and Bioanalyzer 2100 System (Agilent) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis was performed using the Transcriptor first-strand cDNA synthesis kit (Roche) following the manufacturer’s protocol and a primer complimentary to the 3’UTR (Table S2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library preparation was performed using the KAPA HyperPlus Library Preparation Kit (KAPA Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... libraries were quantified using the KAPA library quantification kit for Illumina platforms (Roche). Libraries were pooled at an equimolar concentration (4nM ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis was performed using a Transcriptor first-strand cDNA synthesis kit (Roche) using random hexamers as primers (25°C for 10 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Pooled libraries were quantified using the Kapa library quantification kit (KK4824, Roche, USA). 4 nM library pools were diluted and denatured to 1.3 pM and dual index sequenced on an Illumina Miniseq using a Miniseq Mid Output 300 cycle Reagent kit (FC-420-1004 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody staining was detected with the ultraView Universal DAB Detection Kit (Roche, #5269806001). The slides were scanned with Hamamatsu NanoZoomer S210 (Hamamatsu ...
-
bioRxiv - Immunology 2023Quote: ... and indexed for sequencing on Illumina platforms using a KAPA HyperPrep Kit (Roche). 150 bp paired-end sequencing was performed on Illumina NovaSeq6000.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were generated using the Kapa mRNA HyperPrep kit (Roche, cat. no. KK8581), barcoded with unique dual index adaptors (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... and then processed using in situ Cell Death Detection Kit TMR red (Roche) according to kit conditions and counterstained with 5µg/mL DAPI prior to mounting with Prolong Diamond antifade mountant (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... The libraries were quantified with a KAPA Library Quantification Kit (KAPA Biosystems, KK4873) and the quality and size were analyzed by a fragment analyzer ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed using Lightcycler 480 SYBR Green I Master kit (Roche Diagnostics) using indicated primers (IDT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was extracted following manufacturer’s instructions (High Pure FFPE RNA Micro Kit, Roche). RNA samples with less than 0,01 μg/μL of RNA and less than 0,1 of 260/230 absorbance ratio were excluded from further analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the pool was quantified using the KAPA Library Quantification kit – Illumina (Roche). The libraries were sequenced on an Illumina NextSeq 2000 instrument (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... We recircularized linearized plasmid PCR products with a Rapid DNA Ligation Kit (Roche) and transformed plasmids into DH5α-competent cells (Thermo Fisher) ...
-
bioRxiv - Genomics 2023Quote: Libraries were quantified by qPCR with KAPA library quantification kit for Illumina (Roche) and their size range was checked by capillary electrophoresis using with the DNA high sensitivity kit and a Bioanalyzer 2100 (Agilent Technologies) ...