Labshake search
Citations for Roche :
1751 - 1800 of 7738 citations for 6 Methylimidazo 1 2 a pyridine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Collected media was incubated for 2 hours at 55°C with 20mg/ml proteinase K (Roche). Then ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were cultivated in the presence of IL-2 (10 IU/mL, Roche, Basel, Switzerland). Three days after coinfection cells were sorted based on expression of mouse CD48 and mCD24 (BD biosciences ...
-
Single-cell analysis of shared signatures and transcriptional diversity during zebrafish developmentbioRxiv - Developmental Biology 2023Quote: ... animals in PBST were rocked in 2% blocking buffer (5 g of blocking reagent, Roche, 11096176001) in 1X maleate buffer (150mM maleic acid ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: 400-600 embryos were homogenized in 2 ml 0.5 % Danieau’s with protease inhibitor cocktail (PIC, Roche) and 1 % (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... 2% Triton X-100) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche cOmplete, Sigma Aldrich)] ...
-
bioRxiv - Pathology 2023Quote: ... The digestion was stopped with 2 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitors (Complete-TM, Roche) followed by centrifugation at 18,000 x g for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... CD4+ T cells were cultured in RPMI + IL-2 (final concentration 100 U/mL, Roche, 10799068001), IL-7 (final conc ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was incubated with 2 ml of pre-equilibrated Protein C affinity resin (Roche) for 2h at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... End point cell proliferation was assayed with ELISA 5-bromo-2′ -deoxyuridine (BrdU) kit from Roche Diagnostics (Sigma– Aldrich) ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5-2 M of urea (depending on the construct) and one protease inhibitor cocktail tablet (Roche). Following sonication on ice (10 min at 40 % power ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% BSA (Roche), 20% Dextran Sulfate (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 × PhosSTOP (Roche)] and incubated on ice for 20 min ...
-
bioRxiv - Cell Biology 2019Quote: ... 1× PhosSTOP (Roche)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1× cOmplete (Roche), and lysed by bead-beating ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP40 (Roche) and a phosphatase inhibitor mixture containing 20 mM NaF ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 × PhosSTOP (Roche)] and incubated on ice for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 1/1000 (Roche); HRP-conjugated anti-FLAG antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... PhosSTOP 1% (Roche)) and mechanically with a pellet pestle ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2021Quote: ... mitotic cells were obtained by mitotic shake-off and swelled in hypotonic buffer (75 mM KCl:0.8% NaCitrate:H2O at 1:1:1) with protease inhibitor cocktail (Roche) at room temperature for 10-15 min ...
-
bioRxiv - Microbiology 2020Quote: Whole cell lysates were generated by lysing cells in RIPA buffer (50 mM Tris-Cl [pH 7.4], 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1× Roche complete mini-protease inhibitor cocktail ...
-
bioRxiv - Genomics 2024Quote: ... 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% Sodium Deoxycholate, 0.1% SDS, 1× Protease Inhibitor cocktail, Roche) and incubated at 4 °C for 1 hour with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... pH 6.8, 10 mM DTT, 1 mM EDTA, 0.1% Tween, 1 mM PMSF, 1× Mini Protease Inhibitor Cocktail, Roche). The samples were centrifuged at 3000g for 6 min at 4°C using a tabletop centrifuge ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL trypsin solution (100 ng μL−1 Sequencing grade, Roche Deutschland Holding GmbH ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM phenylmethanesulfonyl fluoride (PMSF) and 1 X protease inhibitors (Roche)] ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% sodium deoxycholate and 1 × EDTA-free protease inhibitor cocktail (Roche) supplemented with Cycloheximide (100 μg/ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-HA (1:10,000; Pierce) or Anti-GFP (1:2000; Roche) served as primary Abs ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µg/ml aprotinin/pepstatin/leupeptin and 1 mM PefaBloc (Roche)) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM EDTA and 1 x cOmplete protease inhibitor cocktail (Roche) with three rounds of freezing in liquid nitrogen and rapid thawing ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-EM48 (1:500; Chemicon) or anti-HA (1:500; Roche) antibodies and developed with biotinylated secondary anti-rabbit (1:500 ...
-
bioRxiv - Physiology 2020Quote: ... digested for 1 hour with collagenase (Roche, 11088831001, 1 mg/ml) in RPMI medium at 37°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 mM DTT and 1 × EDTA-free protease inhibitor cocktail (Roche). Lysates were clarified by centrifugation at 17,000 ×g ...
-
bioRxiv - Plant Biology 2021Quote: ... 10% glycerol) containing 1 mM PMSF and 1× protease inhibitor (ROCHE) followed by incubation for 30 min at 4°C (shaking) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Roche #1814460001; WB 1:1000; IF 1:200), rabbit anti-FLAG (Cell Signaling Technology 2368 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mL human insulin (final concentration 20 μg mL-1, Roche), 1ml BSA (final concentration 50 μg mL-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% sarkosyl and protease inhibitor (1 tablet per 10 ml, Roche), and incubated for 60 min at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT) supplemented with 1 complete protease inhibitor tablet (Roche). 40 mg/mL lysozyme was added to the pellets ...
-
bioRxiv - Plant Biology 2023Quote: ... 1% Triton X-100,10% glycerol) containing 1× Protease Inhibitor Cocktail (Roche) and incubated for 30 min at 4℃ ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM PMSF and 1 x complete protease inhibitor cocktail (Roche). Immunoprecipitation experiments with GFP-trap beads were performed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... lysed by 1 mg mL-1 Collagenase-D (Roche, Basel, Switzerland) for 10 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 14 ml lysis buffer (100 μg/ml Lysozyme, 1 % Triton, 1 mM PMSF, 1 x protease inhibitor (cOmplete, Roche), 10 mM DT ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibodies were diluted in blocking buffer and incubated at room temperature for 1 hour (Sigma Aldrich M2 Flag at 1:1,000; Invitrogen 22C5D8 Pgk1 at 1:6,000; Roche 12CA5 HA at 1:2,000 ...