Labshake search
Citations for Roche :
1751 - 1766 of 1766 citations for 5 Cyanopyridin 3 yl methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Cell pellets were resuspended in lysis buffer (50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl, 5% v/v glycerol, 1 mM TCEP-NaOH, Roche protease inhibitor cocktail EDTA-free) at the ratio of 50 ml / L equiv ...
-
bioRxiv - Developmental Biology 2019Quote: ... and subsequently incubated in antibody solution (5% Sheep serum, 1% Tween20 and 1:2500 dilution of Alkaline Phosphatase-linked α-Digoxigenin antibody, Roche, 11093274910 in TBST) for 2 h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... and homogenized in 5 volumes of ice-cold PBS containing 1% NP-40 and Complete® protease inhibitor cocktail tablets (Roche Diagnostics, Basel, Switzerland) using 2×10 clockwise strokes with 5 s rest time ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Neuroscience 2024Quote: ... resuspended in 150 μL buffer C (50 mM Tris pH 8, 5 mM EDTA, 1% SDS, 100 mM NaCl, 1x Roche complete mini protease inhibitors) and incubated on ice for 10 min ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA (5∼8 μg) for Nanopore sequencing was end-repaired and ligated via a KAPA Hyper Prep Kit (Cat#KR0961, Kapa Biosystems, Wilmington, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cell Biology 2023Quote: ... and lysis buffer A (50 mM Tris-HCl, 5 mM EDTA, 10 mM NaN3, and Complete™ EDTA-free tablet; Roche Diagnostics, Mannheim, Germany); disrupted with glass beads at 4 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were lysed in 100 µl lysis buffer (5 ml contain: 10 mM Tris-HCl pH 7.5, 4% SDS, 1 PhosSTOP tablet [Roche], a scoop of DNase I [NEB]) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 mM NaCl, 30 mM imidazole, 1 M urea, 1% v/v Triton X-100, 5 mM beta-mercaptoethanol, with Roche EDTA-free cOmplete protease inhibitor) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... 42 ℃ for 5 min and 95 ℃ for 10 s followed by 40 cycles of 95℃ for 5 s and 60 ℃ for 20 s on an LightCycler® 480 Instrument (Roche Diagnostics Ltd, Rotkreuz, Switzerland). The absolute quantification of SARS-CoV-2 RNA levels was performed by comparison to a standard curve and shown as SARS-CoV-2 RNA copies per mouse ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Immunology 2024Quote: ... and 0.5% Triton X-100) with 1x protease and phosphatase inhibitors (c0mplete™ Protease Inhibitor Cocktail, Roche, product number 04693159001; PhosSTOP™, Roche, product number 04906837001). The resulting lysate was transferred to a labeled 1.5mL tube and placed on ice ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Physiology 2021Quote: ... denatured for 10 minutes at 80°C in hybridization buffer (0.1M Tris, pH 7.2; 25mM MgCh; 70% formamide [Sigma-Aldrich, Saint Louis, MO], 5% blocking reagent [Roche] with 1.0μg/mL of Cy3-labelled (F3002) CENPB-specific [ATTCGTTGGAAACGGGA] peptide nucleic acid (PNA ...