Labshake search
Citations for Roche :
1751 - 1800 of 8268 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... Glomus cells were dissociated using a mixture of collagenase P (2 mg/ml; Roche Applied Science, Indianapolis, IN), DNase (15 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... Digestion was performed for 30 min at 37⍰C with 2 mg/ml collagenase D (Roche, Meylan, France), 1 mg/ml dispase (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl RNA were incubated for 10 min at room temperature with 0.6 µg baker’s yeast tRNAPhe (Roche), 1 mM MgCl2 and increasing amounts of protein in a volume of 20 µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumor tissue was mechanically dissociated into 2-4mm pieces and then digested in 2.5 mg/mL Liberase and 0.1 mg/mL DNase (Roche) for 1 hour at 37C ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2024Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 10 mM DTT, 0.1% NP-40, and protease inhibitor cocktail [Roche]). Then ...
-
bioRxiv - Developmental Biology 2024Quote: ... animals were incubated in MABTw blocking solution (5% heat-inactivated horse serum, 5% Roche Western Blocking Buffer in MABTw) for 2 hours at room temperature and then incubated in anti-DIG-AP (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001). The supernatants were collected and the beads washed (50μL ...
-
bioRxiv - Neuroscience 2021Quote: ... participants were given either a total of 225mg of L-DOPA (Madopar, Roche, Levodopa/Benserazid, 4:1 ratio) or a placebo (P-Tabletten white 8mm Lichtenstein ...
-
bioRxiv - Microbiology 2021Quote: ... The total qPCR reaction volume was 25 μl and consisted of 4 μl DNA (2,5 ng μl-1) and 12,5 μl LightCycler 480 SYBR Green I Master mix (Roche) containing 0.2 μM PCR primer (Table S5 ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Immunology 2020Quote: ... 1 μM of each primer combination and 4 μL of Lightcycler FastStart DNA MasterPLUS SYBR Green I (Roche) in a total volume of 20 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with DNAse I (4 U/ul) and 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tablet (Roche). The sample was lysed by French press at 17 KPsi (Constant Systems Ltd) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 X protease inhibitor cocktail and 1 X phosphatase inhibitor cocktail from Roche) ...
-
bioRxiv - Immunology 2021Quote: ... and 10% glycerol) containing 1 mM PMSF and 1 × protease inhibitor cocktail (Roche). Then ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM EGTA and 1% Triton X-100 with protease/phosphatase inhibitor (Roche) mixture ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mM DTT) with 1 mM PMSF and protease inhibitor cocktail tablets (Roche) by vigorous shaking in a fast prep cell breaker (Bio 101 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM DTT and 1× cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Fifty micrograms of total protein were loaded onto SDS-PAGE gels and separated by electrophoresis ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mM EDTA and 1×Complete EDTA free-tablet (Roche Diagnostics, Basel, Switzerland) in distilled water ...
-
bioRxiv - Microbiology 2024Quote: ... Lysozyme 1 mg/ml and 1 tablet of EDTA-free protease inhibitor (ROCHE). Cells were broken passing twice through an Emulsiflex C5 (ATA scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... in a 1:1 ratio and added to white 384 well plates (Roche). Plates were run on a 45-cycle protocol using the LC 480 II system (Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 mM EDTA and supplemented with 1× Complete protease inhibitor cocktail (Roche) by using a Teflon pestle (Schuett Biotec) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM Na3VO4 and 1 mM NaF) supplemented with protease inhibitor cocktail (Roche) and incubated on ice for 30 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM DTT and 1 tablet of complete EDTA-free (Roche, Basel Switzerland)] ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM DTT and 1 tablet of complete EDTA-free (Roche, Basel Switzerland)] ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM Na3VO4 and 1 mM NaF) supplemented with protease inhibitor cocktail (Roche) and incubated on ice for 30-60 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 25mM NaCl, 1 mM EGTA, 1.5 mM MgCl2, 1 mM DTT, 1% Triton TX-100, 10% Glycerol, 1X Roche Complete protease inhibitors) during 1h at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tumor tissues were minced into 1×1 mm fragments and enzymatically dissociated in HBSS containing 1 mg/ml collagenase A (#11088793001; Roche, Basel, Switzerland) and 1 μg/ml DNase I (#07900 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were lysed in 1500 μl ice cold RIPA buffer (50 mM Tris-Cl pH 7.4, 150 mM NaCl, 1% NP40, 0.5% Na-deoxycholate, 0.1% SDS, 1 mM EDTA, Roche cOmplete and 1 mM PMSF). Cell lysates were clarified by centrifugation (13000 x g at 4°C for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mM EDTA) supplemented with 1 mM PMSF and 1 tablet of cOmplete Protease inhibitor (Roche, cat. No. 11 873 580 001) per 50 ml using a MP Biomedical Fast-Prep-24 5G bead beater ...
-
bioRxiv - Neuroscience 2024Quote: ... volume of lysis buffer (25 mM HEPES pH 7.5, 200 mM NaCl, 1 μg ml−1 benzonase, 1 mM PMSF and Roche protease inhibitor tablets). Cells were lysed by dounce homogenization and the NALCN complex was subsequently solubilized by addition of 2% (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... volume of lysis buffer (25 mM HEPES pH 7.5, 150 mM NaCl, 1 μg ml−1 benzonase, 1 mM PMSF and Roche protease inhibitor tablets). Cells were lysed by dounce homogenization and the NALCN complex was subsequently solubilized by addition of 2% (w/v ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting pellet was washed four times with buffer II (10 mM Tris–HCl pH 8.0, 10 mM MgCl2, 0.25 M sucrose, 1% triton X-100, 1 mM DTT, 0.1mM PMSF, 1% Roche protease inhibitor cocktail tablet) until the green color was completely removed ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % Triton-X and 5 % blocking reagent (Roche) and rabbit anti-GFP antibody (A11122 ...