Labshake search
Citations for Roche :
1701 - 1750 of 2003 citations for Phospholipase A and Acyltransferase 4 RARRES3 PLAAT4 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were then stained for HMGXB4-HA and HMGXB4SUMO -HA using a HA tag antibody (Roche Applied Science) and Fibrillin with Anti-Fibrillin 1 antibody (abcam ...
-
bioRxiv - Microbiology 2020Quote: ... IFAs were carried out on methanol-fixed cells using primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:100 and rabbit α-PfHP1 12 ...
-
bioRxiv - Neuroscience 2021Quote: ... Fcgr1 mRNA signal was then detected using sheep anti-DIG antibody (1:500; Roche Diagnostics Corp., Indianapolis, IN) followed by the secondary antibody (Donkey anti-sheep IgG Alexa 488 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The detection kit for the antibodies is the UltraView DAB detection Kit (Ventana Medical Systems Inc./ Roche Diagnostic). A counter-staining of the nuclei was used for 12 minutes by Hematoxylin ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h with rat anti-HA high affinity monoclonal antibodies (Roche Applied Science, Penzberg, Germany) at 1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... and polymerized by UV light prior to labeling with anti-HA antibody (Roche, clone 3F10, 1:40 dilution) and 10nm gold bead conjugated goat anti-rat (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of hybridized probes was performed with anti-DIG antibodies AP fragments (Roche, Basel Switzerland; dilution 1:1000) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Cancer Biology 2020Quote: ... was used to remove excess antibody and amplified C-circles were detected with CDP-Star® kit (Roche). Membranes were imaged with the Odyssey® Fc Imager (LI-COR ...
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Immunology 2023Quote: ... in antibody buffer (20 mM HEPES pH 7.5; 150 mM NaCl; 0.5 mM Spermidine; 1X Protease inhibitor cocktail (Roche); 0.05% Digitonin ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Genetics 2023Quote: ... Cells were incubated overnight in primary antibodies targeting GFP to stain GFP labelled CTCF or RAD21 (Roche, 11814460001) or SON (abcam ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... sorted cells were washed with PBS and resuspended in Antibody Buffer (1X eBioscience Perm/Wash Buffer, 1X Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Systems Biology 2023Quote: ... subsequently transferred to polyvinylidene fluoride membranes and probed with the anti-GFP primary antibody (Roche, Mouse monoclonal, #11814460001) and goat AffiniPure anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunodetection was performed using an anti-DIG antibody coupled to alkaline phosphatase (Anti-Digoxygenin-AP, Fab fragments, Roche), whose activity was detected by the chromogenic method using NBT/BCIP (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal antibodies were used to detect green fluorescent protein (GFP) (Cat#11814460001, clones 7.1 and 13.1, Roche). Rabbit polyclonal anti-Cdc42p antibodies were provided by Dr ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... Hybridized probes were detected by anti-DIG antibodies conjugated with alkaline phosphatase enzyme (anti-DIG-AP) (Roche, Germany). Photographs were captured using an Olympus BX51 compound microscope using a DP74 Olympus camera.
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 20% of the elution sample volume was analyzed by western blotting with α-HA tag antibody (#3F10, Roche) for Sly1-HA immunodetection.
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was first performed with high or low pH buffer depending on the primary antibody (CC1m, Roche or low pH antigen retrieval buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... probes were detected using anti-digoxigenin and anti-fluorescein antibodies with Fab fragments conjugated to horseradish peroxidase (Roche). 1:500 fluor-tyramide (TAMRA or FAM) ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were incubated in primary antibody diluted in blocking buffer [rat anti-HA HRP 1:500 (Roche 12013819001), mouse anti-tubulin 1:1000 (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Pathology 2024Quote: ... Pre-cleared lysates (containing 1 mg of protein) were then incubated with mouse monoclonal anti-GFP antibodies (Roche) coupled to G-protein beads for 3 h at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Detection of DIG-labeled probes were performed by incubation with a mouse monoclonal anti-DIG primary antibody (Roche), followed by incubation with Cy3-labeled goat anti-mouse IgG secondary antibody (EMD Millipore) ...
-
bioRxiv - Cell Biology 2024Quote: ... the samples were washed two times with 300 μL of 1%BSA antibody buffer (20mM HEPES– KOH, pH 7.5, 150 mM KCl,0.5 mM Spermidine, 1X Roche cOmplete Mini EDTA-free Protease Inhibitor ...
-
bioRxiv - Immunology 2024Quote: ... CD3 primary antibodies were detected using an anti-rabbit HQ detection system (catalog# 7017936001 and 7017812001, Roche Diagnostics) followed by OPAL 570 (NEL871001KT ...
-
bioRxiv - Immunology 2024Quote: ... CD11c primary antibodies were detected using an anti-rabbit HQ detection system (catalog# 7017936001 and 7017812001, Roche Diagnostics) followed by OPAL 690 (NEL871001KT ...
-
bioRxiv - Immunology 2024Quote: ... Sorted cells were washed with PBS and resuspended in Antibody Buffer (1 × eBioscience Perm/Wash Buffer, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: Western blots were carried out as described previously (Díaz-López et al., 2019) using the following primary antibodies: anti-EGFP (11814460001, Roche), anti-dsRed (a gift from José María Requena ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... 150 mM NaCl and 0.1% (v/v) Tween 20] and probed with anti-GFP mouse monoclonal antibodies (Roche) followed by goat anti-mouse horseradish peroxidase (HRP ...
-
bioRxiv - Cell Biology 2024Quote: ... PCMD-1 transgene proteins with GFP-tag were probed with a GFP antibody (mouse monoclonal 1:600, Roche) or α-Tubulin antibody (mouse monoclonal 1:7500 ...
-
bioRxiv - Cell Biology 2024Quote: ... Detection was carried out using horseradish peroxidase-conjugated secondary antibodies and enhanced chemoluminescence (Roche Diagnostics, Germany/Advansta, USA). Densitometric analysis was performed using ImageJ.
-
bioRxiv - Developmental Biology 2024Quote: ... Localization of HA tagged proteins were analyzed with an anti-HA tag antibody (Roche, clone 3F10, 1 : 500) and Alexa Fluor coupled secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... Cell lysates were cleared by centrifugation at 13 000 g for 30 min and supernatants were incubated for 30 min with 2.5 μg/sample anti-HA antibodies (clone 3F10, Roche) bound to 50 μL/sample (or 1.5 mg/sample ...