Labshake search
Citations for Roche :
1701 - 1750 of 7737 citations for 6 Bromo 2 4 fluoro phenyl imidazo 1 2 a pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Genetics 2021Quote: ... and 0.2 μl of glucose-6-phosphate isomerase (PGI, Roche, #10127396001), while another 20 μl was incubated with 980 μl Glucose Reagent (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... using 6 ml of FuGENE HD transfection reagent (Roche Diagnostic, USA) in 100ml of OPTIMEM medium (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: Cells were transfected with the appropriate plasmids using Fugene 6 (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and RCAS-Cre using a Fugene 6 transfection kit (Roche, 11814443001) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... with virus packaging and envelope expressing plasmids using Fugene-6 (Roche). Medium was replaced with DMEM with 10% FCS the next day and supernatant was harvested 3 days post-transfection ...
-
bioRxiv - Immunology 2023Quote: ... T237M or V1092A mutated hALPK1 cDNA constructs using FuGENE 6 (Roche).
-
bioRxiv - Neuroscience 2024Quote: ... The transfection process utilized 6 μl of FuGENE (Roche Applied Science) and 2 μg of various plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... Magnetic beads were washed 2 times with lysis buffer and 4 times with washing buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mg/ml Pefabloc SC (Roche), and EDTA-free protease inhibitor cocktail (cOmplete Tablets ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 1 h and then incubated overnight at 4 °C in block solution with diluted DIG-antibodies (1:5,000) conjugated with alkaline phosphatase (AP) (Roche). To visualize WISH signal ...
-
bioRxiv - Immunology 2021Quote: Mouse tracheal epithelial cells were isolated from tracheas digested overnight at 4 °C in Ham’s F12 medium plus pronase (1 mg/ml; Roche). Cells were cultured for 3 h on Primaria plates (Falcon ...
-
bioRxiv - Plant Biology 2020Quote: ... roots were incubated overnight at 4°C in anti-myc-mouse primary antibody (1:250, Roche in blocking solution), washed 3 times in PBST ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
Toxoplasma GRA15 limits parasite growth in IFNγ-activated fibroblasts through TRAF ubiquitin ligasesbioRxiv - Immunology 2020Quote: ... The membrane was blotted overnight at 4°C with rat antibody against the HA tag (Roche, 1/500 dilution), TRAF2 and TRAF6 rabbit antibodies (Suppl ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight at 4°C in B1 buffer with alkaline phosphatase-conjugated anti-DIG (1/2000; Roche 11633716001). After three washes in B1 buffer and one wash in B3 buffer (100 mM Tris–HCl pH 9 ...
-
bioRxiv - Genomics 2021Quote: ... Samples were then incubated overnight at 4°C with a rabbit anti-DIG HRP-conjugate antibody (1:500, Roche). Then ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with 1:2000 alkaline phosphatase-conjugated anti-DIG antibodies (Sigma/Roche, 11093274910). After washes and prior to development ...
-
bioRxiv - Cell Biology 2021Quote: ... PH7.4, 150 mM NaCl, 1 mM MgCl2, 20% glycerol, 0.2% NP-40, and 1X protease inhibitor cocktail from Roche) for protein extraction ...
-
bioRxiv - Neuroscience 2021Quote: ... Tween-20 0.3%) for 1 hour and finally incubated overnight at 4°C with anti-Dig-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were incubated overnight at 4°C with monoclonal mouse anti-GFP antibody (Roche; Basel, CH; dilution 1:500) or monoclonal rat anti-HA antibody (Roche ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gonadal tissues were washed three times in 0.2× SSC at 50 °C for 15 min each and transferred to 4× SSC containing 1% blocking reagent (Roche) for 1 h at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated overnight at 4°C with anti-digoxigenin-alkaline phosphatase antibodies (1:5000; Roche; 11093274910; AB_514497) diluted in blocking solution ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Tissues were washed in three changes of 0.2× SSC at 44°C for 15 minutes each and blocked in 4×SSC containing 1% blocking reagent (Roche) in 4× SSC for 1 hour at RT ...
-
bioRxiv - Biochemistry 2023Quote: ... were homogenised with 1:4 weigth per volume diethylamine (DEA) buffer (50 mM NaCl, 0.2% diethylamine, pH 10, cOmplete Protease InhibitorsTM, Roche). After 60 min at 130000xg and 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Primary antibodies were incubated overnight at 4°C: rabbit anti-HA high affinity at 1:500 (Roche Diagnostics #ROAHAHA), mouse anti-FLAG M2 at 1:500 (Sigma-Aldrich #F1804) ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were then rinsed with PBS and lysed at 4°C in Buffer A (1% Triton X-100, 0.5% NaDOC and 1X cOmplete Protease Inhibitor Cocktail (Roche) in PBS) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Washed three times for 30 minutes each in TNTT at 4 ℃ to remove methanol.Blocked with 1% blocking reagents (Roche) in TNTT buffer for 2 hours at 4 ℃ to prevent no specific binding ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed using the extracted DNA (100 ng) as template with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Plant Biology 2019Quote: ... the cDNA samples were diluted with 220 µl distilled water and 2 μl aliquots were amplified with the LightCycler® Nano Real-time PCR Detection System (Roche Applied Science, Tokyo, Japan) using the KOD SYBR® qRT-PCR Mix (TOYOBO) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5X SSC, 5X Denhardt’s solution, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water). Incubation with pre-hybridization buffer was carried out during 4h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50% formamide, 5X SSC, 5X Denhardt’s, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water) containing biotin and/or digoxin labeled Locked Nucleic Acid (LNATM ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were then thawed and resuspended in 1 ml lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 0.5 mg/ml lysozyme, 2 mM EDTA and one Roche protease inhibitor tablet per 10 ml). Complete lysis was achieved after a 15-min incubation at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg sequencing grade trypsin (Roche) was dissolved in 165 μL ice cold trypsin digestion buffer and added to resin in the spin columns with the bottom capped ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mg/mL DNAase (Roche, 04716728001). The cells were resuspended by mechanical agitation through Pasteur pipettes flamed with decreasing diameters ...
-
bioRxiv - Developmental Biology 2020Quote: ... Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche) transfection reagent following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was stained for 6 min with 0.5 μg/ml DAPI (Roche) and coverslips mounted in Vectashield (Vector H-1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 % Igepal CA630) supplemented with 50 μl 6 x Complete (Roche, 04693132001) and 3 μl protease inhibitor (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: U2OS cells were transfected with the indicated plasmids with Fugene 6 (Roche) according to manufacturer’s instructions using a 3:1 Fugene/plasmid ratio ...
-
bioRxiv - Plant Biology 2019Quote: ... 4 °C) the cleared supernatants were diluted 1 time using water containing 1x cOmplete ™ EDTA-free protease inhibitor (Roche). Protein extract was incubated overnight with anti-HA antibodies (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... bovine serum albumin in TBS-T and incubated for 16 h at 4°C: mouse anti-GFP (1:1000) (Roche), sheep anti-CK1α (1:100 ...