Labshake search
Citations for Roche :
1601 - 1650 of 4756 citations for PhotoCol IRG Methacrylated Collagen + Irgacure Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... a second sequencing library was created using the KAPA HyperPrep Plus kit (Roche) and purified with 0.8x volumes of AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... The pool was quantified by qPCR using the KAPA Library Quantification Kit (Roche) then sequenced on the Illumina NextSeq500 sequencer using the 75nt high-output flow cell ...
-
bioRxiv - Developmental Biology 2021Quote: ... To detect cell death the “In Situ Cell Death AP kit” (Roche, #11684809910) was used ...
-
bioRxiv - Neuroscience 2021Quote: ... alkaline phosphatase activity was detected using an HNPP fluorescence detection kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ATP was determined using ATP Bioluminescence Assay Kit HS II (Roche, Mannheim, Germany) according to manufacturer’s instructions with some modifications ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed using a Transcriptor first-strand cDNA synthesis kit (Roche) using random hexamers as primers (25°C for10 min ...
-
bioRxiv - Immunology 2020Quote: ... ATP bioluminescense assay kit HS-II and Protease inhibitor cocktail was from Roche. Flou-4AM was from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... DNA sequencing libraries were prepared using the PCR-free KAPA HyperPrep Kit (Roche). Libraries were sequenced on an Illumina NextSeq 500 and the quality of the raw sequencing reads was analysed with FastQC (version 0.11.4 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using the High Pure Viral RNA Kit (Roche, Basel, Switzerland). Partial RdRp was amplified using the SuperScript III OneStep RT-PCR and Platinum Taq Enzyme kit (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... whose copy number was determined using the Cobas 6800 HIV-1 kit (Roche) was included in every RNA isolation/qPCR run ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was harvested using the High Pure RNA Isolation Kit (Roche, Basel, Switzerland). Two independent samples were analyzed ...
-
bioRxiv - Immunology 2020Quote: ... total RNA was converted into sequencing libraries using mRNA HyperPrep kit (KAPA/Roche) and custom Illumina-compatible unique dual index (UDI ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using the Roche Transcriptor First Strand Kit (04896866001, Roche). qPCR was carried out using cDNA diluted 1:7 ...
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche, (07962193001). Libraries were quantified using a KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by real-time PCR using the KAPA Library Quantification kit (Roche) with the QuantStudio-7flex Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by real-time PCR using the KAPA Library Quantification kit (Roche) with the QuantStudio-7flex Real-Time PCR system (Thermo) ...
-
bioRxiv - Genetics 2020Quote: ... Library generation was performed using the KAPA Hyper Prep Kit (KK8504, Kapa Biosystems). After amplification and quantification ...
-
bioRxiv - Immunology 2021Quote: ... The following qRT-PCR was performed using a RealTime Ready PCR Kit (Roche) and Taqman primer-primer-probe mixes ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-seq library was constructed by KAPA mRNA Hyper Prep Kit (KAPA BIOSYSTEMS) and SeqCap Adapter Kit (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by qPCR using a Kapa Library Quantification Kit (Kapa Biosystems, KK4835).
-
bioRxiv - Cancer Biology 2020Quote: ... then quantified using the KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems). Libraries were submitted to PE75 sequencing on Illumina NextSeq500 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA extraction was performed manually using the High Pure RNA isolation kit (Roche) with an on-column DNase treatment according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-seq libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The shotgun sequencing library was constructed using the KAPA Hyper Prep Kit (Roche). Libraries were sequenced on the DNBSEQ-G400 (BGI ...
-
bioRxiv - Neuroscience 2022Quote: TUNEL staining was performed using the in-situ cell death detection kit (Roche) in sagittal paraffin sections of 4μm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were prepared by using the KAPA HyperPrep kit (Roche, Basel, Switzerland, # 7962363001) according to the manufacturer’s specifications ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed using the FastStart Essential DNA Green Master kit (Roche, 06924204001) on LightCycler® 96 instrument (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was extracted using the High Pure RNA isolation kit (Roche Molecular Systems) according to manufacturer’s instructions and following the general precautions required for RNA work (39) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA fragments were prepared with the KAPA HTP Library Preparation Kit (Roche) for sequencing ...
-
bioRxiv - Genomics 2022Quote: ... and libraries prepared using the KAPA Hyper Prep kit for DNA (Roche KK8504). Truncated universal stub adapters were ligated to DNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library enrichment was performed with the KAPA HotStart PCR kit (Roche Diagnostics KK2502) in 50 μl of total reaction volume (10 μl 5X KAPA buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... We measured ATP concentration with the “ATP bioluminescence assay kit HS II” (Roche) according to the manufacturer instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was synthesized with Transcriptor First Strand cDNA synthesis kit (Roche, Basel, Switzerland). qPCR experiments were performed using QuantStudio 5 Real-time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: The In Situ Cell Death Detection Kit Fluorescein (Roche, N°11684-795-910) was used for detecting dying cells in intact Hv_Basel ...
-
bioRxiv - Cell Biology 2022Quote: ... Library preparation was done with the KAPA DNA or RNA Hyperprep kit (Roche). Ligation was made with Illumina dual-index UMI (IDT) ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled (2.5nM) ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled (0.23nM) ...
-
bioRxiv - Genomics 2022Quote: ... Linear NGS library construction was performed using a KAPA HyperPrep library kit (Roche) according to published protocols ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... constructed barcoded libraries for sequencing using KAPA HyperPrep kits (Roche Sequencing, Pleasanton, CA) with a target fragment size of 500 bp ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation was performed using a commercially available kit provided by KAPA Biosystems (KAPA Hyper Prep with Library Amplification Primer Mix ...
-
bioRxiv - Genomics 2022Quote: Libraries are quantified via qPCR using the KAPA Library Quantification Kit (Roche 0796020400), which specifically analyzes sequencing-competent fragments ...
-
bioRxiv - Genomics 2022Quote: BANC-seq libraries were prepared using the Kapa Hyper Prep Kit (Kapa Biosystems) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was done with the SYBR Green I Master kit (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... LDH release levels were analyzed using a Cytotoxicity Detection Kit (Roche, Basel, Switzerland). Purified Ply(1μM)was co-cultured with various concentrations of alnustone at 37°C for 30min ...
-
bioRxiv - Microbiology 2022Quote: ... The KAPA HiFi Hot Start Ready Mix kit (Kapa Biosystems, Woburn, MA, USA) was used for PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...