Labshake search
Citations for Roche :
1601 - 1650 of 7002 citations for Methyl 2 trifluoromethylsulfonyloxy 1 naphthoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were spun (420 RCF x 2 min on LCM-3000 plate centrifuge (Grant Instruments, Royston, UK) before analysis on the Light Cycler 480 (Roche). Samples were run for 50 cycles (10s at 95°C and 30s at 60°C) ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... hippocampi from each animal were homogenized in ice-cold Homogenization buffer (2 M sucrose, 500 mM HEPES (pH 7,4)) containing complete Protease Inhibitor (Roche/Sigma) and spun down for 10 min at 1000 x g at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... qPCRs were performed using specific primers for each gene (Supplementary Table 2) in Roche LightCycler 480 real-time PCR machine using Lightcycler 480 Sybr Green I Master kit (Roche). Actin was used as a reference gene (Supplementary Figure 1) ...
-
bioRxiv - Synthetic Biology 2022Quote: Pellets were lysed via sonication of a 33 percent (w/v) cell suspension in 10 mM Tris pH 7.5/2 mM CaCl2 with protease inhibitor (Roche, 11836170001), cleared with centrifugation at 4C ...
-
bioRxiv - Neuroscience 2022Quote: ... the reaction was performed with 2 x Hieff qPCR SYBR Green Master Mix (Yeasen) and detected by LightCycle 480 Real-Time PCR machine (Roche). For RNA-seq ...
-
bioRxiv - Plant Biology 2022Quote: ... Glucose content was then measured by spectrophotometry after a 2 enzymes reaction with hexokinase and glucose-6-phosphate dehydrogenase (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... To lyse the cells medium was removed and the well was washed with 2 ml ice cold PBS before 100 µl lysis buffer was applied (RIPA buffer supplemented with PhosSTOP (Roche) and protease inhibitors (cOmplete Mini ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM EDTA) supplemented with a cocktail of protease inhibitors (Complete Protease Inhibitor without EDTA, Roche Applied Science, Indianapolis, IN) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail 3 ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR (RT-qPCR) used 2×RealStar Green Fast Mixture (GenStar) with a Real-time PCR Detection System (LightCycler96, Roche). The following primers were used in the amplification ...
-
bioRxiv - Bioengineering 2021Quote: ... P14 CD8+ T cells were activated for 24 h as described above and resuspended in T cell media + 30 U/ml rhIL-2 (Roche) at 2 × 106 cell/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... The skin was finely minced with a scalpel and placed for 30 min at 37 °C on a shaker in a digesting enzyme cocktail of 2 mg/ml Collagenase P (Roche), 2 mg/ml Dispase (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 mM EGTA) with Halt phosphatase buffer inhibitor (Fisher: PI78420) and Complete mini EDTA-free protease inhibitor (Roche: 4693159001). Samples were sonicated at low power (Qsonica Q55 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Cell Biology 2022Quote: ... pancreas was perfused through the common bile duct with 2 mL of 0.8 mg/mL collagenase P (Roche, Indianapolis, IN) in Hanks’ balanced salt solution [HBSS] with Ca2+ and Mg2+ (Corning ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was removed and the well was washed with 2 ml ice cold PBS before 100 μl lysis buffer were applied (RIPA buffer supplemented with PhosSTOP; Roche) and protease inhibitors (complete Mini ...
-
bioRxiv - Microbiology 2020Quote: The cell viability of circPSD3 siRNA treated cells was determined at day 2 post-transfection using Cell Proliferation Kit I (MTT, Roche) as previously described [59].
-
bioRxiv - Microbiology 2021Quote: ... The cell pellet was then resuspended in 300 μL of homogenization buffer (150 mM KCl, 20 mM HEPES pH 7.4, 2 mM EDTA, cOmplete Mini Protease Inhibitor Cocktail tablet-Roche 04693124001). For the unfractionated sample ...
-
bioRxiv - Cancer Biology 2020Quote: Tumors from MMTV-PyMT mice and C3(1)-Tag mice were resected and minced using a razor blade in DMEM containing 2 mg/mL collagenase and 100 U/mL hyaluronidase (Roche) in a rotator at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Pellets were thawed on ice and suspended in 2 mL of lysis buffer A (50 mM NaPO4, pH 7.3, 300 mM NaCl, 2 mM β-mercaptoethanol, 20% glycerol and Roche cOmplete protease inhibitor (1 tablet per 10 mL)) ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % sodium deoxycholate and 1 % Triton X-100 as well as protease inhibitors (10 mg / ml leupeptin, pepstatin A, 4-(2-aminoethyl) benzensulfonyl-fluorid and aprotinin) and phosphatase inhibitors (PhosSTOP−, Roche). Total cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Physiology 2021Quote: ... fish were taken out of their chamber one by one for a 2-min chase protocol (Roche et al., 2013) and returned in their chamber for immediate measurement of to estimate their maximum metabolic rate MMR (Fig ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5X SSC, 100 µg/ml heparin, 100 µg/ml yeast RNA, 0.1% TritonX-100, 0.1% CHAPS, 2% Roche blocking reagent) for more than an hour at 60–65 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... GTP binding Irgb6 crystals diffracting to 1.5 Å resolution were obtained from sitting drops with a 9 mg/ml protein solution containing 2 mM GTP (Roche) and a reservoir solution consisting of 0.1 M Sodium Citrate buffer pH 5.4 (Wako) ...
-
bioRxiv - Genomics 2020Quote: Barcoded 2×300 bp metagenomic libraries were prepared with the KAPA Hyperplus Library Preparation kit (KAPA Biosystems, Wilmington, MA, US) and sequenced on an Illumina MiSeq system at the National Oceanography Centre (Southampton ...
-
bioRxiv - Cancer Biology 2021Quote: The in vitro synthesis of digoxigenin (DIG)-labeled antisense SatIII probe (158 bp SatIII repeat cloned in 1μg of PGEM-2-98 construct) with T7 RNA polymerase was carried out using the DIG labeling kit from Roche Products Pvt ...
-
bioRxiv - Immunology 2020Quote: ... Dissociation was performed with 150-200 embryos for each sample after 2 hours beclomethasone or vehicle treatment (started at 28 hpf) using Liberase TL (Roche) and stopped by adding Fetal Calf Serum (FCS ...
-
bioRxiv - Immunology 2020Quote: Age- and sex-matched mice were challenged by intravenous injection of CpG (2 μg premixed with 15 μl DOTAP (Roche) in DPBS ...
-
bioRxiv - Microbiology 2021Quote: ... and transfected with plasmid pIIIH5red-SARS-2-S DNA using X-tremeGENE HP DNA Transfection Reagent (Roche Diagnostics, Penzberg, Germany) according to the manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bisulfite-treated DNA was amplified by nested PCR (Supplementary Table 2) using KAPA HiFi HS Uracil+ ReadyMix (Kapa Biosystems). In the first and second rounds of PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Genomics 2021Quote: Bisulfite converted DNA was amplified and barcoded in 50 µL PCR reaction (22 µL bisulfite-converted DNA, 25 µL 2× KAPA HiFi HotStart Uracil+ ReadyMix (Roche), 1.5 µL 10 µM i5 universal PCR primer ...
-
bioRxiv - Genomics 2021Quote: ... Early passage cells were seeded at 25% confluency in six-well plates and transfected with 2 ug of expression vector using Fugene reagent (Roche). Cells were harvested and seeded into 100 mm dishes after 48 h of transfection ...
-
bioRxiv - Plant Biology 2023Quote: ... Glucose production rates were determined at 2 h using an Accu-Chek ®Aviva glucometer (Roche Diagnostics Scandinavia AB, Sweden). Monosaccharide (arabinose ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted in PBS for 2 hours at room temperature after which they were counterstained with 300 nM 4’,6’-diamino-2-phenylindole (DAPI; 10236276001, Roche) for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell pellet was resuspended and homogenized in buffer B supplemented with 2 mM MgCl2 and 1x protease inhibitor (Roche). The protein was extracted by incubating with 1% GDN (Anatrace ...
-
bioRxiv - Biochemistry 2023Quote: ... cell pellets were resuspended in HR buffer (50 mM Tris-HCl, 5 mM MgCl2, 250 mM sucrose, 2 mM TCEP and protease inhibitor t (Roche), pH 7.4) ...
-
bioRxiv - Immunology 2023Quote: ... Kidneys were homogenized using the Miltenyi gentleMACS Dissociator and digested for 20 minutes at 37°C in RPMI with 2 mg/mL collagenase D (Roche) and 0.1 mg/mL DNAse I ...
-
bioRxiv - Cancer Biology 2023Quote: ... glands were minced into paste and incubated in 5 mL DME/F-12 medium (HyClone, #SH30023.1) with 2 mg/mL collagenase A (Roche #10103578001), 100 units/mL hyaluronidase (Sigma-Aldrich ...