Labshake search
Citations for Roche :
1601 - 1650 of 7422 citations for 6 Bromo 2 trifluoromethylimidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 mM MES pH 6 plus protease inhibitor cocktail (Roche); lysates were centrifuged 10 min at 800xg ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized with random p(dN)6 primers (Roche) and MMLV reverse transcriptase (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... C-33A cells were transiently transfected using FuGENE 6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Digestion was performed with 6 units of MNase (Roche 10107921001) in 500 μl of a 20 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid transfections were carried out by FuGENE 6 (Roche, E269A) as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized with random primers p(dN)6 (Roche) using SuperScript III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... XG1 cells were supplemented with IL-6 (Roche, 3ng/ml).
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:50 in dH2O and mixed with an equal volume of target-specific primers and Roche 2×SYBR master mix (Roche, Cat No.04707516001). Plates were centrifuged at 1000 rpm for 1 min and stored at 4°C in the dark until ready for use ...
-
bioRxiv - Developmental Biology 2022Quote: ... but with several differences from incubation with the anti-DIG antibody on: Incubation with blocking Buffer (2% Blocking Reagent from ROCHE in MABTween 1x) for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We induced transient expression of the plasmids in 106 cells resuspended in 2 ml using the polymer X-tremeGENE 9 DNA Transfection Reagent (Roche Applied Sciences 06365787001) following manufacturer’s instructions (1 μg total DNA and 3 μl reagent in 100 μl FBS-free culture medium) ...
-
bioRxiv - Genomics 2020Quote: ... SeqCap library preparation was performed using custom Nimblegen SeqCap probes (described above in §2.1) according to the NimbleGen SeqCap EZ HyperCap Workflow User’s Guide Ver 2 (Roche Sequencing Solutions, Inc., CA USA). Following capture ...
-
bioRxiv - Microbiology 2020Quote: Deidentified remnant patient samples that underwent routine clinical testing with the cobas SARS-CoV-2 assay on the 6800 platform (Roche Diagnostics, Indianapolis, IN) were used to evaluate the Xpert and ID Now assays ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Triton X-100, 150 mM NaCl, 10% glycerol, and 2 mM EDTA plus one Complete EDTA-free protease inhibitor tablet [Roche] per 50 ml) for 1 hr ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Cell Biology 2022Quote: ... triton X-100 in HBSS for 10 min and incubated with blocking solution containing 2% (w/v) bovine serum albumin fraction V (Roche, Woerden, The Netherlands) and 0.1% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
bioRxiv - Biochemistry 2022Quote: ... pellets were resuspended in lysis buffer (50 mM HEPES pH 8, 400 mM NaCl, 75 mM Imidazole pH 8, 5% v/v glycerol, 5 mM 2-Mercaptoethanol, supplemented with Roche Protease Inhibitor Tablets) and lysed using an Emulsiflex-05 homogenizer ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 μL of the diluted cDNAs and the KAPA SYBR ® FAST qPCR Kit Optimized for Light Cycler ® 480 (KAPA biosystems). Differences between samples and controls were calculated based on the 2−ΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 12.5 ng of purified DNA from each sample was used as a template for PCR amplification in 25 μl reaction mixture by using 2 × KAPA HiFi Hot Start Ready Mix (Kapa Biosystems, MA, USA). For PCR amplification ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed adding 2 μl of DNAse-treated RNA to 17 μl reaction mixture containing 1X Expand Reverse Transcriptase Buffer (Roche Diagnostics, Mannheim, Germany), 10mM of Dithiothreitol (DTT ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293 cells were transiently transfected with β-arrestin 2-Renilla luciferase 8 (Rluc8) and human C5aR2-Venus constructs using XTG9 (Roche, Sydney, Australia) for 24 h ...
-
bioRxiv - Physiology 2020Quote: ... finely cut with scissors and incubated in digestion medium (PBS with 2% BSA, 1M CaCl2, 94U/ml dispase II and 100mg/ml collagenase D, Roche Life Science, France) at 37°C for 30-40min ...
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates were extracted with phosphate-buffered saline (PBS) containing 2 % Triton X-100 and protease inhibitors (Roche Complete, Roche Diagnostics, Mannheim, Germany). Protein concentrations were determined by BCA-assay (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Microbiology 2023Quote: Capture-based libraries were prepared following the KAPA RNA HyperCap workflow with specific enrichment probes for SARS-CoV-2 (Roche Diagnostics, Mannheim, Germany). Each individual library was created using 10ul of extracted RNA input and following the protocol established by the kit’s manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... was performed in 2-day-old cells according to the manufacturer’s protocol (TMR red in situ cell death detection kit, Roche Diagnostics GmbH, Heidelberg, Germany) with modifications as described earlier (Smetana et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was discarded and the pure nuclear pellets were resuspended in boiling buffer (100mM Tris pH8.0, 2% SDS, 100μM PUGNAc, and Roche EDTA-free protease inhibitor cocktail) [59] ...
-
bioRxiv - Biophysics 2024Quote: ... Purified motor proteins were diluted to indicated concentrations in the assay buffer with 2 mM of corresponding nucleotides (ATP-Chem Imex, ADP-Sigma Aldrich, or AMPPNP-Roche Diagnostics GmbH)fr ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 50-200 mL of room temperature Ribosome Lysis Buffer supplemented with 2 EDTA-free protease inhibitor tablets (Roche, Catalog Number 04693132001), Turbo DNAse (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 100-200 mL of room temperature eIF3 Lysis Buffer supplemented with 2 ethylenediamine tetraacetic acid (EDTA)-free protease inhibitor tablets (Roche, Catalog Number 04693132001), 20 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... To maintain the carryover ≤ 20% with intra-day and inter-day (2 d) CV%≤ 20% acceptable for bioanalytical assays ((Clouser-Roche et al., 2008), it was necessary to perform intermediate a post-run wash injection following each standard and sample injection ...
-
bioRxiv - Microbiology 2024Quote: ... 12 ng of genomic DNA was amplified in a 25 µL reaction comprised of 2x Kapa HiFi Master Mix (Roche cat # KK2601/2), 1 µL of 10 µM V4 515F/806R primers with Illumina adapters (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGYCAGCMGCCGCGGTAA -3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Genetics 2021Quote: ... and 0.2 μl of glucose-6-phosphate isomerase (PGI, Roche, #10127396001), while another 20 μl was incubated with 980 μl Glucose Reagent (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... using 6 ml of FuGENE HD transfection reagent (Roche Diagnostic, USA) in 100ml of OPTIMEM medium (Invitrogen ...