Labshake search
Citations for Roche :
1551 - 1600 of 8731 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were cultivated in the presence of IL-2 (10 IU/mL, Roche, Basel, Switzerland). Three days after coinfection cells were sorted based on expression of mouse CD48 and mCD24 (BD biosciences ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: 400-600 embryos were homogenized in 2 ml 0.5 % Danieau’s with protease inhibitor cocktail (PIC, Roche) and 1 % (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... 2% Triton X-100) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche cOmplete, Sigma Aldrich)] ...
-
bioRxiv - Pathology 2023Quote: ... The digestion was stopped with 2 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitors (Complete-TM, Roche) followed by centrifugation at 18,000 x g for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... CD4+ T cells were cultured in RPMI + IL-2 (final concentration 100 U/mL, Roche, 10799068001), IL-7 (final conc ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was incubated with 2 ml of pre-equilibrated Protein C affinity resin (Roche) for 2h at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Collected media was incubated for 2 hours at 55°C with 20mg/ml proteinase K (Roche). Then ...
-
bioRxiv - Cell Biology 2024Quote: ... D-Mel (d.mel-2) cells were transfected using X-tremeGene HP DNA transfection reagent (#06366236001, Roche). Two days after transfection ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1% sodium dodecyl sulfate) supplemented with 2% v/v protease inhibitor cocktail (Roche; Catalog #11697498001) and 1% v/v phosphatase inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM ß-glycerophosphate, 5 mM NaF, 1 mM Na3VO4) and protease inhibitors (Roche cOmplete ULTRA Tablets, EDTA-free). The lysates were sonicated on ice (4x 10s bursts ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Physiology 2021Quote: ... containing cOmplete EDTA-free protease inhibitor cocktail at a concentration of 1 tablet/7 ml (Roche Applied Science, Indianapolis, IN, USA)) by repeated passage through a 20-gauge needle to obtain plasma membrane-enriched preparations ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol) containing 1× complete EDTA-free protease inhibitor cocktail (Roche). Insoluble debris was removed by centrifugation at 15000 rpm for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatants were diluted 1:4 with ice-cold dilution buffer (1× phos-stop [Roche], 0.5% NP-40, 1 mM DTT) and centrifuged again at 15,000 rpm for 15 minutes at 4°C to precipitate actomyosin components ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Molecular Biology 2019Quote: ... were lysed in IP buffer (10 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM PMSF and Roche complete EDTA free protease inhibitor cocktail) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and incubated in buffer A (50 mM MMT pH 8.0/300 mM KCl/10 mM MgCl2/5 % glycerol) containing 1 g L-1 lysozyme/2.5 U mL-1/SmDNAse//complete protease inhibitor cocktail (Roche) for 1 h prior to lysis using EmulsiFlex C5 (Avestin ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Biochemistry 2021Quote: ... 150 mM sodium chloride (NaCl), 20% glycerol, and 1 mM Dithiothreitol (DTT, Scientific) supplemented with one Complete EDTA free protease inhibitor tablet (Roche) per 50 ml lysis buffer ...
-
bioRxiv - Biophysics 2019Quote: ... 10 mM Na4P2O7 and 10 mM EDTA supplemented with 1% (v/v) Triton X-100 and one complete protease inhibitor cocktail tablet (Roche)) ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL of the reverse transcrip-tion mix from the Titan One Tube RT-PCR System kit (Roche, Switzerland) was added ...
-
bioRxiv - Microbiology 2019Quote: ... 10 mM imidazole and 2 mM β-mercaptoethanol) supplemented with DNaseI (AppliChem) and Complete Protease inhibitor (Roche). After one passage through a French press cell ...
-
bioRxiv - Developmental Biology 2019Quote: ... slides were washed in 0.2x SSC then transferred to MBST before blocking with 2% blocking solution (Roche) for at least 1 hr at RT ...
-
bioRxiv - Cell Biology 2019Quote: ... samples were further incubated for 2 hrs in 40 µl pre-cleared protein-G agarose beads (Roche). Beads with immunocomplexes were centrifuged at 3,000 × g and washed four times in lysis buffer with intermittent incubations ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.05M Tris HCl pH 7.9, 5μM MgCl2, 5μM CaCl2, 2% SDS supplemented with 1x protease inhibitor cocktail, ROCHE) by sonication on ice ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM imidazole and 2 mM β-mercaptoethanol) supplemented with DNaseI (AppliChem) and Complete Protease inhibitor (Roche). After one passage through a French press cell ...
-
bioRxiv - Microbiology 2020Quote: ... Cobas SARS-CoV-2 PCR Test for the Cobas 6800 System (Roche Molecular Systems, Branchburg, NJ, USA) was used to detect the presence of SARS-CoV-2 [11].
-
bioRxiv - Genetics 2022Quote: ... The PCR procedure was performed by adding 25μL 2 × KAPA HiFi HotStart Ready Mix (KAPA biosystems, KM2602) with 2.5ul primers of NEB Oligos kit and 2.5ul Illumina universal primers ...
-
bioRxiv - Genetics 2021Quote: ... Worms were then resuspended in 0.4 ml Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and dripped into liquid N2 with 1 ml pipette tips to form small pearls ...
-
bioRxiv - Immunology 2020Quote: ... Fresh tissue was initially cut into small pieces and digested with collagenase VI (2 mg/ml; Roche) for 30 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: Pellets of 1x107 cells were lysed with 1mL Co-IP Lysis Buffer (300mM NaCl, 50mM Tris HCL pH7.4, 0.5% NP40, 0.1% Sodium deoxycholate, 2% SDS) with PhosSTOP (Roche) and cOmplete (Roche ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Immunology 2020Quote: An aliquot was thawed and tested at NorthShore using the Elecsys Anti-SARS-CoV-2 (Roche Diagnostics), Access SARS-CoV-2 IgG (Beckman Coulter) ...
-
bioRxiv - Immunology 2022Quote: ... Creatinine levels were measured with the COBAS INTEGRA Creatinine Jaffé Gen.2 Kit (Roche Diagnostics, Indianapolis, IN). To assess severity of proteinuria ...
-
bioRxiv - Immunology 2022Quote: ... C57BL/6NCrl mice were given either 2% (w/v) Glucose water or 10% (v/v) Ethanol (Roche) and 2% (w/v ...