Labshake search
Citations for Roche :
1501 - 1550 of 10000+ citations for Rat Indoleamine 2 3 Dioxygenase 1 IDO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... samples were covered with the staining mixture at 37 °C for 1 h following instructions of the In Situ Cell Death Detection Kit (Roche, 11684795910). After the TUNEL reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Genomics 2022Quote: ... Positivity of SARS-CoV-2 infection was assessed both by PCR and measurement of specific antibodies (Cobas-Roche using Elecsys Anti-SARS-CoV-2 S). All patients gave their consent for participation in this study ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA of 1 μg from each sample was reverse transcribed with random hexamers using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... by the capillary method and hybridised with digoxigenin-labelled blaOXA- 58 and blaNDM-1-specific probes with an NBT/BCIP colour detection kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... The samples were boiled at 95°C for 5 minutes and diluted 1:1000 in dilution buffer provided in ATP luminescence kit HSII (Roche, Cat# 11699709001). The further assay was performed as instructed by the kit’s manual in Luminometer (Promega GloMax96 Microplate Luminometer) ...
-
bioRxiv - Plant Biology 2020Quote: ... In situ nick-end labeling of nuclear DNA fragmentation was performed for 1 h in the dark at 37°C using the In-Situ cell death detection kit (Roche Applied Science) according to the manufacturer’s manual ...
-
bioRxiv - Cell Biology 2020Quote: ... Mip1α and housekeeping gene β-actin was evaluated by quantitative RT-PCR using the LightCycler 480 SYBR Green 1 Master kit and LightCycler 480 II (Roche, Indianapolis, IN) and oligos ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1 µg RNA was used for cDNA synthesis with oligo(dT)12-18 using Transcriptor first-strand synthesis kit (Roche, Basel, Switzerland). Transcript levels were measured by qRT-PCR using LightCycler 480 SYBR Green I Master (Roche ...
-
bioRxiv - Pathology 2022Quote: RNA was reverse-transcribed and amplified using the TaqMan Fast Virus 1-Step Master Mix RT-qPCR kit (LifeTechnologies, Carlsbad, CA) on the LightCycler 480 or LC96 instrument (Roche, Indianapolis, IN), and quantified by interpolation onto a standard curve made up of serial tenfold dilutions of in vitro transcribed RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... a maximum of 1 μg of sheared DNA was used for library preparation using the KAPA HTP Prep Kit (KAPA Biosystems, KK8234) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5 min or TRAP staining with a TRAP/ALP Stain Kit (FUJIFILM Wako Pure Chemical Corporation) for 30 min or ALP staining with NBT/BICP solution (Roche; 1:100) for 15 min followed by AR staining prepared from 1% AR Solution at pH 6.3-6.4 (MUTO PURE CHEMICALS CO. ...
-
bioRxiv - Evolutionary Biology 2024Quote: Paired-end sequencing libraries for QTL-Seq analysis were prepared using >1 μg of pooled DNA with a KAPA HyperPrep PCR-free kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Exome libraries were prepared from 1 μg of genomic DNA from each analyzed section using the Nimblegen EZ Exome kit V3 (Roche, Nutley, NJ). Paired-end 100 bp sequencing was performed on a HiSeq2500 sequencer (Illumina Inc. ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2 supplemented with protease and phosphatase inhibitor cocktails (Roche)) for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 M NaCl with Complete protease inhibitor tablet (Roche, Indianapolis, IN) and centrifuged for 30 min at 13,000 rpm 4°C to pellet cell debris ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM EDTA) supplemented with EDTA-free protease inhibitor cocktail (Roche), phosphatase inhibitor (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Plant Biology 2019Quote: ... cOmplete mini protease inhibitor cocktail (2% v/v; Roche Molecular Biochemicals). Before NMR analysis D2O (5% to 10% v/v depending on frequency of spectrometer ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 2 mg/mL of collagenase A (Roche, Basel, Switzerland) and 1× DNase I (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated in blocking buffer (2% blocking reagent (Roche, 11096176001) in 1x TNT ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was permeabilised in 2% Triton-X-100 (Roche, 40319421) in PBS and subsequently incubated in PBSGT blocking solution (0.2% gelatin ...
-
bioRxiv - Systems Biology 2021Quote: ... 2% fatty acid-free bovine serum albumin (BSA) fraction V (Roche), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 mL ready-to-use CDP-Star® (Roche, USA) was added to cover the blot completely ...