Labshake search
Citations for Roche :
1501 - 1550 of 7871 citations for 6 AMINO 6 DEOXY 1 2 3 4 DI O ISOPROPYLIDENE D GALACTOPYRANOSIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Phosphorylation of the Smooth Muscle Master Splicing Regulator RBPMS Regulates its Splicing ActivitybioRxiv - Molecular Biology 2022Quote: ... and 2 cOmpleteTM mini protease inhibitor cocktail (Roche) tablets were added to the cell suspension followed by cell lysis using a French Press (Stansted) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 tablets complete EDTA-free protease inhibitor (Roche)) followed by 5 min incubation at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 ml of diluted Liberase TH (Roche, 05401151001) was then added to the plate ...
-
bioRxiv - Cell Biology 2023Quote: ... digested in 2 mg/ml Collagenase P (Roche) for 45 min and filtered through sieves with 70 and 40 µm pore size ...
-
bioRxiv - Molecular Biology 2023Quote: ... and KAPA HiFi Uracil+ mastermix (Roche, KK2801/2) using the following protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... BSA fraction V (2% wt/vol) (Roche Diagnostics), 2-mercaptoethanol (50 µM) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg/ml lysozyme and protease inhibitors (Roche) per 1 L of culture ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% sodium dodecyl buffer (SDS)] containing protease (Roche) and phosphatase (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% SDS and a cocktail protease inhibitor (Roche)] ...
-
bioRxiv - Cell Biology 2023Quote: ... 5mM EDTA and 2% Protease inhibitor (Roche, Complete) boiled for 10 min at 70°C in SDS loading buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.01% digitonin + 2 U/mL RNase inhibitor (Roche). Epicardial preparations (2 biological replicates at 10PWC ...
-
bioRxiv - Microbiology 2023Quote: ... and 2) a KAPA HiFi PCR kit (Roche) was used to perform the amplification in place of the reagents included in the Nextera XT kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 tablets complete EDTA-free protease inhibitor (Roche)) followed by 5 min incubation at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μl of micrococcal nuclease (Nuclease S7, Roche) was added and the lysates were incubated at 25 °C for 18 min using a thermal cycler (Techne-Prime ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL 20 mg/mL Glycogen (Roche, 10901393001)) at 37°C for 2 hr and subsequently subjected to Proteinase K (15 μL 10% SDS ...
-
Identification of plants functional counterparts of the metazoan Mediator of DNA Damage Checkpoint 1bioRxiv - Cell Biology 2023Quote: ... 2 µl/ml Benzonase) containing protease inhibitors (Roche) and sonicated for 2 min (5’’on/5’’off ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM DTT with Protease inhibitor cocktail (Roche) and incubated for 10 min on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM EDTA complemented with phosphatase ihibitor (Roche Diagnostics Scandinavia AB ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 2 mg/ml collagenase/dispase (Roche, 10269638) at 37°C for 40 min with gentle agitation ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mg/ml collagenase A (#1013586001, Roche, Switzerland), 0.2 mM CaCl2 (#C5670 ...
-
Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss With Childhood OnsetbioRxiv - Neuroscience 2023Quote: ... Terminal transferase (2 µl/ml; Roche, Basel, Switzerland) and biotinylated dUTP (1 µl/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 mM NaCl, 1 mM MgCl2, 10 mM Imidazole, 0.5% IGEPAL® CA-630, 2 mM β-Mercapto-ethanol supplemented with Roche cOmplete inhibitor cocktail tablets) at a ratio of 15 ml of buffer/g of biomass ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM MgCl2; 2 mM EGTA pH 8.0; 0.1% Triton X-100; 0.1 mM PMSF; 1x Roche Complete protease inhibitors cocktail) supplemented with increasing NaCl concentrations (80-600 mM ...
-
bioRxiv - Cancer Biology 2022Quote: NGS libraries were prepared from extracted gDNAs following a 2-step PCR protocol with 2 x KAPA Mastermix (KK2612, KAPA Biosystems). For spleen Tregs and CD4s ...
-
bioRxiv - Cancer Biology 2024Quote: ... The aqueous phase from each MaXtract tube (∼400 µl) was then transferred to 1.5 ml tubes containing 2 µl of 2 µg/µl glycogen (Roche, Cat# 10901393001), 1 ml ethanol was added ...
-
bioRxiv - Molecular Biology 2021Quote: ... Final DNA concentration of 1μM and increasing concentrations of Stl (0.5-8 μM) were mixed with 1μg/ml poly(d[I-C]) (Roche) in EMSA buffer (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Plant Biology 2021Quote: ... and 0.33 M D-sorbitol supplemented with one tablet (per 50 mL) of cOmplete protease inhibitor cocktail (Roche)] using a Waring blender ...
-
bioRxiv - Microbiology 2022Quote: ... and the right inferior lung lobes were digested at 37°C with 630 µg/mL collagenase D (Roche) and 75 U/mL of DNase I (Sigma–Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... The remaining tissue was incubated in digestion buffer (RPMI 1640, 10% FCS, 1.25 mg/ml collagenase D (Roche), 0.85 mg/ml collagenase V (Sigma– Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... followed by a 20-min incubation at 37°C in CSS containing 1.5 mg/ml Collagenase D (Roche), 0.6 mM EDTA ...
-
bioRxiv - Immunology 2020Quote: Single cell suspensions of the tumor were obtained after tumor digestion with 400U/mL of collagenase D (Roche) at 37C for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... lung tissue was minced with a scalpel and digested enzymatically with 0.15 WU/mL of D-Liberase (Roche) and 800□U/mL of DNase I (Sigma-Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... Muscle was then digested in a 15 ml Falcon tube containing 2.4 U/ml Collagenase D (11088882001, Roche), 12 U/ml Dispase II (04942078001 ...
-
bioRxiv - Genomics 2021Quote: ... The concentration of each 10x single cell and V(D)J library was determined through qPCR (Kapa Biosystems) to produce cluster counts appropriate for the NovaSeq 6000 platform ...
-
bioRxiv - Immunology 2022Quote: ... they were digested for 30 minutes at 37°C in PBS 1X containing 1mg/mL Collagenase D (Roche), 100 U/mL DNAse I (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... Lamina propria-resident immune cells from large intestine were isolated by digesting intestinal tissue with Collagenase D (Roche), Collagenase V (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... the lung was perfused with PBS and digested for 45 minutes with 625μg/mL collagenase D (Roche, 11088875103) and 75U/mL DNase I (Sigma ...
-
bioRxiv - Immunology 2023Quote: Cells were isolated from the brain by mechanical disruption followed by collagenase D digestion (Roche Pharmaceuticals, Mannheim, Germany). The resulting cell suspension was resuspended in 40% Percoll (GE Healthcare Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: Histological staining included terminal transferase mediated d-UTP nick end labelling (TUNEL) with Co/Ni enhancement (Roche, UK) performed following manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Lungs were perfused with sterile PBS and digested for 45 minutes with 625μg/mL collagenase D (Roche 11088875103) and 75U/mL DNase I (Sigma D4527) ...
-
bioRxiv - Microbiology 2024Quote: ... Lactate was quantified using a lactate assay kit (D-Lactic/L-Lactic acid UV method, r-biopharm, Roche). All samples were measured using fresh growth medium as control.
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...