Labshake search
Citations for Roche :
1501 - 1550 of 3087 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... After physical disaggregation and digestion with 2 mg/ml collagenase B (Roche, CA, USA), the enzymatic activity was stopped by diluting with PBS 1X ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cell pellets were treated with 1 mL of 2 mg/mL lysozyme (Roche, Switzerland) and incubated at 30 °C for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM EDTA pH 8.0 and 0.1% BSA supplemented with protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal ProbeLibrary Assay Design Center (Roche, Supplementary Table 2) and transcript levels of candidate genes were measured by qRT-PCR using the TaqMan hPSC Scorecard™ Panel (384 well ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... qPCR was performed using SYBR FAST ABI Prism 2× qPCR Master Mix (Kapa BioSystems). Amplification was carried out in a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were incubated in blocking solution (10% sheep serum, 2% blocking reagent (Roche), 0.3% Tween-20 in MAB ...
-
bioRxiv - Biochemistry 2024Quote: ... Next, 50 µl of lytic buffer was added (2% NP-40, protease inhibitors (Roche), 0.2 µM LargeBiT (produced in house ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was treated with 2 mg/mL of pronase from Streptomyces griseus (Roche) in 50 mM Tris-HCl pH 7.0 for 1.5 h at 60°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
Faa1 membrane binding drives positive feedback in autophagosome biogenesis via fatty acid activationbioRxiv - Biochemistry 2023Quote: ... 2 mM MgCl2) and finally resuspended in lysis buffer containing complete protease inhibitors (Roche), an FY-inhibitor mix (Serva) ...
-
bioRxiv - Microbiology 2023Quote: ... DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Genomics 2022Quote: ... PCR was performed by adding 10μl 2×HiFi PCR mix (Kapa Biosystems, Cat. 7958927001) and 0.5μl 60mM SINGV6 primer and running the following program ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and blocked for 60 minutes in PBS-T with 2% blocking reagent (Roche, UK), 5% foetal calf serum (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μl of 10 mM dNTPs and 10 units of Transcriptor Reverse Transcriptase (Roche).
-
bioRxiv - Immunology 2023Quote: Spleens were incubated for 20 min with 2 mg/mL collagenase D (Roche, #11088858001) and then mashed through a 70-μm cell strainer ...
-
bioRxiv - Cell Biology 2023Quote: ... the stripped endothelium–Descemet’s layer was incubated with 2 mg/ml collagenase A (Roche) solution in human endothelial serum free media (SFM ...
-
bioRxiv - Genomics 2024Quote: ... The colony PCR was performed in 2 × KAPA HiFi DNA polymerase (Kapa Biosystems, USA) and 10μM primers under conditions of 3 min at 95 °C ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell pellets were lysed in 2% SDS buffer supplemented with complete Protease (Roche, 11697498001) and PhosSTOP phosphatase (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). AE1/AE3 (Leica Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). Glut-1 (2B scientist ...
-
bioRxiv - Immunology 2024Quote: ... the cells (108/ml) were pretreated with 2 mM Pefabloc SC Plus (Roche #11873601001) for 15 min at 37 °C with rotation set to 10 RPM ...
-
bioRxiv - Microbiology 2024Quote: ... Cobas TaqMan RealTime HIV-1 (version 1 or 2; Hoffmann-La Roche, Basel, Switzerland) or the Abbott RealTime HIV-1 assay (Abbot Laboratories ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of 10x DIG labeling mix 10x DIG labeling mix (Roche, Basel, Switzerland), 0.5 µl of RiboLock RNase inhibitor (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a 2:1:1 ratio using X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001). The supernatants were collected and the beads washed (50μL ...
-
bioRxiv - Neuroscience 2021Quote: ... participants were given either a total of 225mg of L-DOPA (Madopar, Roche, Levodopa/Benserazid, 4:1 ratio) or a placebo (P-Tabletten white 8mm Lichtenstein ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs or plasmid DNAs using Dharmafect 4 (Dharmacon) or Fugene 6 (Roche Applied Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were then probed overnight at 4℃ in anti-GFP (mouse monoclonal IgG1κ, cat#: 11814460001 Millipore Sigma/Roche) diluted 1:1000 in 5% Applichem nonfat dried milk in TBS-T ...
-
bioRxiv - Microbiology 2021Quote: ... The total qPCR reaction volume was 25 μl and consisted of 4 μl DNA (2,5 ng μl-1) and 12,5 μl LightCycler 480 SYBR Green I Master mix (Roche) containing 0.2 μM PCR primer (Table S5 ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Immunology 2020Quote: ... 1 μM of each primer combination and 4 μL of Lightcycler FastStart DNA MasterPLUS SYBR Green I (Roche) in a total volume of 20 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Cell Biology 2021Quote: ... was homogenized and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and chromatin was extracted overnight at 4°C in 0.5X PBS (67.5 mM NaCl) with a protease inhibitor cocktail (Roche) on an end-over-end rotator ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were incubated at 37°C for 3-4 h before adding DNase I (0.1 U/µl) (Roche) and incubating for another 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with DNAse I (4 U/ul) and 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tablet (Roche). The sample was lysed by French press at 17 KPsi (Constant Systems Ltd) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections on slides were post-fixed at 4% PFA in 0.1M PB and treated with proteinase K (Roche). Sections were hybridized with digoxigenin (DIG)-labeled probes at 72°C overnight in hybridization solution ...
-
bioRxiv - Physiology 2023Quote: ... Tissues were chopped with scissors and digested in a cocktail containing 4 units/mL LiberaseTM (Roche; Catalog# 355374) and 0.744 units/mL Elastase (Worthington Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 8.5 was added and this reaction was treated with 4 Units of Alkaline Phosphatase (Roche Life Science) at 37°C for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... colonic biopsies (n=3-4 per patient) were enzymatically digested using 0.5 Wünsch units/ml Liberase TM (Roche) and DNase I at 10µg/ml at 37°C (a protocol previously optimized in our lab)(43) ...
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...