Labshake search
Citations for Roche :
1451 - 1500 of 3204 citations for 6 Hydroxy 2 4 5 triaminopyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: 2 mg of the isolated RNA was digested with DNAse I (Roche) and cDNA was synthesized using the GoScript reverse transcription kit A5001 (Promega) ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 mM 2-mercaptoethanol] containing one tablet of protease inhibitor cocktail (Roche), which can inhibit a broad spectrum of serine and cysteine proteases ...
-
bioRxiv - Microbiology 2024Quote: ... 2) step - 1:0.85 using Kapa HyperPure Beads (Roche, cat. no. 07983298001). Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol and 2 protease inhibitor cocktail tablets (cOmplete, EDTA free, Roche)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% sodium dodecyl sulfate (SDS)] supplemented with complete protease inhibitor cocktail (Roche Diagnostics Corp. ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μL of 2× Sybr Green (LightCycler 96, Roche Molecular Systems, Inc.), 200 nM of each primer ...
-
bioRxiv - Genomics 2024Quote: ... Each PCR reaction contained 26.25Lμl 2× KAPA HiFi HotStart master mix (Roche), 2.5Lμl of 10LμM TruSeq RPIX primer (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 μl of RNase-free DNase I (20 μ/ml, Roche) were added to the washed antibody beads and were precipitated ON rotating at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: Tissue sections were dissected using the reference mask image from serial section 6 to collect regions of interest using medium or large AVENIO Millisect milling tips (Roche Sequencing Solutions, Pleasanton, CA), collected with Molecular Grade Mineral Oil (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 μl of each nucleotide mix and Nick translation mix (Hoffmann-La Roche, Basel, Switzerland) were added ...
-
bioRxiv - Cancer Biology 2019Quote: ... each well was treated with enzyme mixture: 750 µl Collegenase/Dispase 4 mg/ml (Roche, #10269638001), 30 mg BSA (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM of phosphatase inhibitors (β-glycerophosphate, NaF and NEM) and 1 tablet of PhosStop (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were incubated overnight at 4 °C with rat anti-HA Abs at 1:200 (Roche) and guinea-pig anti-red fluorescent protein (RFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4°) in lysis buffer (50 Tris-HCl, 150 mM NaCl, Roche complete EDTA-free protease inhibitor); centrifugation for 30 min at 4° and 21,000xg allowed isolation of the soluble fraction supernatant.
-
bioRxiv - Plant Biology 2021Quote: ... After 4 weeks of culture on MSD medium supplemented with 50 mg/L hygromycin (Roche, Germany), the resistant callus lines were transferred onto RM plates to generate transgenic rice seedlings ...
-
bioRxiv - Developmental Biology 2019Quote: ... the sections were incubated overnight at 4°C with alkaline phosphatase–conjugated antibodies to digoxigenin (Roche) at a dilution of 1:2000 in the same solution ...
-
bioRxiv - Genomics 2021Quote: ... The resulting libraries were amplified with 4 PCR cycles using KAPA HiFi Uracil+ PCR enzyme (Roche). Libraries were quality controlled on a TapeStation 2200 HSD1000.
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Then the samples were incubated overnight at 4 °C with proliferation marker Ki67 (790–4286, Roche). After 3 washes with PBS ...
-
bioRxiv - Immunology 2022Quote: ... were coated O/N at 4 °C with 50 μl of fibronectin (50 μg/ml; Roche) or VCAM-1-Fc (10 μg/ml R&D System) ...
-
bioRxiv - Neuroscience 2023Quote: ... PH 7.5)) and then incubated overnight at 4 °C in anti-DIG POD antibody (Roche, 11207733910) diluted 1:300 in blocking solution ...
-
bioRxiv - Plant Biology 2023Quote: ... The membranes were probed overnight at 4°C with monoclonal anti-GFP primary antibodies (Roche, 11814460001) at 1:1,000 and then with anti-mouse peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells which were fixed with 4% paraformaldehyde solution in vPBS containing EDTA-free protease inhibitor (Roche) were first incubated with 0.25 % (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... Larvae were incubated overnight at 4°C in horseradish peroxidase-coupled anti-FITC antiserum (11426346910, Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were incubated overnight at 4°C in alkaline phosphatase-coupled anti-FITC antiserum (11426338910, Roche) diluted 1:5000 in blocking buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Immunology 2021Quote: ... 5% Sarkosyl) and samples were treated with proteinase K (50μg/mL) and Ribonuclease A (Roche) for 30 minutes at 37°C to remove contaminating proteins and RNA ...
-
bioRxiv - Genomics 2020Quote: ... Cells were washed in 2X PIC (Roche mini-tabs, 1 tab in 5 ml = 2X) and stored at -80°C until needed.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM EDTA at pH 8) containing protease inhibitors (cOmplete mini EDTA-free tablets, Roche) for 30 mins on ice ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.25 μM gene-specific primers and 5 μl LightCycler 480 SYBR Green I Master (Roche) on a Roche LightCycler 480 II real-time PCR System according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with one EDTA-free protease inhibitor mini tablet / 5 ml of buffer (Roche #4693159001). Lysates were incubated on ice for 15 min ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.2% IGEPAL and 5 mM EDTA) and supplemented with a protease inhibitor cocktail (Roche diagnostics). Samples were centrifuged at 2,350 g for 10 min at 4°C and the supernatant was collected ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM sodium pyrophosphate) containing 0.05% PMSF and EDTA-free Complete protease inhibitor cocktail (Roche). Equal volume of acid washed 0.45 mm glass beads (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 5% glycerol) containing 100 mM Phenylmethylsulphonylfluoride (PMSF) and EDTA-free Protease inhibitor cocktail tablets (Roche). Resuspended cells were first treated with 1 mg/ml Lysozyme to digest the cell wall and subsequently frozen at −80°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... consisting of MS1 with 300 mg/L carbenicillin and 5 mg/L hygromycin (Roche, Germany) (YFT1-CDS) ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were prepared using 5 μL of FastStart SYBR Green Master mix (Roche Diagnostics) with a final concentration of 1μM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... membranes were blocked in 5% BSA (BSA Fraction V; Roche Life Sciences, Almere, The Netherlands) in TBS-T or 5% milk in TBS-T for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Molecular Biology 2019Quote: ... 1.5 μl DNA Pol Mix (5 U/μl, Expand Long Template PCR System, Roche Diagnostics), 27.25 μl PCR HPLC Gradient Grade H2O and 1 μl template (primary WTA product) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 2ME [pH 7.5]) supplemented with protease and phosphatase inhibitors (Roche, Indianapolis, IN) for 20 minutes on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM EDTA) and freshly added PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001). Equal amounts of protein (30 μg ...
-
bioRxiv - Cell Biology 2019Quote: ... ATP 5 mM) supplemented with proteases and phosphatase inhibitors (cOmplete EDTA-free and PhosSTOP, Roche). Cells were homogenized in a ball homogenizer with 10 μm clearance ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... A 5% Triton X-100 solution with 1x protease inhibitors (Roche Complete Mini, EDTA free) was added 1:1 to a 50 μl worm pellet ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... S.p.a) and midazolam (0,5 mg kg −1) (Dormicum®, 5 mg/ml, Roche Pharma, Switzerland) for IM premedication before the start of the procedure ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...