Labshake search
Citations for Roche :
1451 - 1500 of 2146 citations for 2 Chloro 3 6 chlorohexanoyl pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... 0.5-2 M of urea (depending on the construct) and one protease inhibitor cocktail tablet (Roche). Following sonication on ice (10 min at 40 % power ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μg of plasmid was transfected using 2 μL X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: Colony PCR reactions were then performed as follows: 2 µL of KAPA HiFi HotStart ReadyMix (Roche) was assembled with 0.8 µL of 1:10 bacteria dilution ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 2 hours at room temperature and then incubated in anti-DIG-AP (Roche, 1:2000) overnight at 4°C and washed and developed with Fast Blue as described in (King 2013) ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Strand-specific RNA libraries were prepared for sequencing (3 - 4 biological replicates/treatment) using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, MA, USA). Poly-A mRNAs were purified from 100 ng of total RNA using poly-T-oligo-magnetic beads (Kapa Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked with 3% BSA in HBSS buffer for 20 min and incubated with a primary antibody (rat anti-HA, Roche, RD11867423001, 1:100) overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.05M Tris HCl pH 7.9, 5μM MgCl2, 5μM CaCl2, 2% SDS supplemented with 1x protease inhibitor cocktail, ROCHE) by sonication on ice ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 M NaCl 1 mM TCEP) supplemented by one protease inhibitor cocktail tablet Complete EDTA-free (Roche) and centrifuged for 30 min at 18,000 g 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol and supplemented with complete EDTA-free cocktail tablets (1 tablet/50ml cells; Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM imidazole and 2 mM β-mercaptoethanol) supplemented with DNaseI (AppliChem) and Complete Protease inhibitor (Roche). After one passage through a French press cell ...
-
bioRxiv - Microbiology 2020Quote: ... Cobas SARS-CoV-2 PCR Test for the Cobas 6800 System (Roche Molecular Systems, Branchburg, NJ, USA) was used to detect the presence of SARS-CoV-2 [11].
-
bioRxiv - Microbiology 2022Quote: All samples were tested with: (1) the Roche Nucleocapsid Elecsys Anti-SARS-Cov-2 (Roche, IND, USA) assay (to confirm eligibility) ...
-
bioRxiv - Genetics 2022Quote: ... The PCR procedure was performed by adding 25μL 2 × KAPA HiFi HotStart Ready Mix (KAPA biosystems, KM2602) with 2.5ul primers of NEB Oligos kit and 2.5ul Illumina universal primers ...
-
bioRxiv - Genetics 2021Quote: ... which was suspended into 1 ml cold Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and 5 μl Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Genetics 2021Quote: ... Worms were then resuspended in 0.4 ml Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and dripped into liquid N2 with 1 ml pipette tips to form small pearls ...
-
bioRxiv - Immunology 2020Quote: ... Fresh tissue was initially cut into small pieces and digested with collagenase VI (2 mg/ml; Roche) for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: Pellets of 1x107 cells were lysed with 1mL Co-IP Lysis Buffer (300mM NaCl, 50mM Tris HCL pH7.4, 0.5% NP40, 0.1% Sodium deoxycholate, 2% SDS) with PhosSTOP (Roche) and cOmplete (Roche ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Immunology 2020Quote: An aliquot was thawed and tested at NorthShore using the Elecsys Anti-SARS-CoV-2 (Roche Diagnostics), Access SARS-CoV-2 IgG (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2020Quote: A subcutaneous dose (1 or 2 mg/kg of weight) of diazepam (DZPM, Valium ®, Roche; México) or saline solution (SAL ...
-
bioRxiv - Cell Biology 2022Quote: ... Then samples were treated at 37 °C for 2 h with 500 µL of RNAse A (Roche) 2 mg/mL and after 30 min with 200 µL of pepsin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: The beads were supplemented with a PCR mix comprising 20 μl of 2× HotStart Readymix (Kapa Biosystems), 4 μl of 5′ end biotin-modified P7 primer (10 μM ...
-
bioRxiv - Physiology 2022Quote: Islets were isolated by injecting 2 mL collagenaseP (0.8 mg/mL in HBSS, Roche Diagnostics, Catalog # 11249002001) into the bile duct with the ampulla of Vater clamped ...
-
bioRxiv - Microbiology 2022Quote: ... amplified using primers LN112 and LN113 (Table 2) and the PCR DIG Synthesis Kit (Roche, Basel, Switzerland) as a probe ...
-
bioRxiv - Genomics 2024Quote: ... the embryos were transferred to pre-hybridization buffer (50% deionized formamide, 5x SSC pH 4.5, 2% Roche Blocking Reagent ...
-
bioRxiv - Bioengineering 2024Quote: ... Pre-hybridization was carried out at 48°C for 2 hours in DIG Easy Hyb buffer (Roche). The trnI/A probe was denaturalized for 20 minutes at 68°C and used for hybridization overnight at 48°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.15% NP40, 1 x Complete protease inhibitors, Roche) and rotated at 4 °C for 2 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA produced was diluted 1:2 for use with LightCycler 480 SYBR Green I Master (Roche) with the primers listed in the section above ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl of target RNA were incubated for 15 min with 0.6 µg baker’s yeast tRNAPhe (Roche), 1 mM MgCl2 and increasing amounts of protein in a volume of 20 µl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 mM tris(2-carboxyethyl)phosphine (TCEP) and protease inhibitor (cOmplete EDTA-free Protease Inhibitor Cocktail, Roche)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... pH 7.5) and placed in RBR buffer (20% Goat serum, 2% Roche Blocking Reagent in 1x MAB) on the orbital rocker for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Immunology 2023Quote: ... after cutting SVF into small pieces and incubation in a 2 mg/ml collagenase D solution (Roche) at 37°C in a water bath for 45 min ...
-
bioRxiv - Immunology 2022Quote: ... Creatinine levels were measured with the COBAS INTEGRA Creatinine Jaffé Gen.2 Kit (Roche Diagnostics, Indianapolis, IN). To assess severity of proteinuria ...