Labshake search
Citations for Roche :
101 - 150 of 6875 citations for Somatostatin Receptor 1 SSTR1 Rabbit Polyclonal affinity purified Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... were coupled to 2.5μg α-HA (high affinity) antibody (Roche) or 5 μg α-FLAG (M2 clone ...
-
bioRxiv - Microbiology 2020Quote: ... Ulp1 and cleaved affinity tag were removed by NiNTA (Roche). The NiNTA flow through was adjusted to 250mM NaCl and purified on HiTRAP-SP (20mM HEPES pH 7.3 ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were treated with anti-HA (Pierce High-Affinity, Roche) primary antibody and primary antibody for the trafficking marker of interest (anti-RAB5a ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was loaded onto a Nickel affinity column (Roche), washed in the loading buffer and eluted in a buffer containing 200mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant was incubated with anti-myc affinity matrix (Roche) for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit anti-GFP (1:1000; 11814460001, Roche). Secondary antibodies used were HRP-conjugated ...
-
bioRxiv - Developmental Biology 2021Quote: ... and digoxigenin (DIG)-labeled dNTPs (Roche) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and labeled with digoxigenin (Roche, 11175025910). Hybridization was performed with 1 to 5 μg/ml cRNA probes at 65 °C for 20 to 24 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... labeled with digoxigenin-11-dUTP (Roche) was used to localize 35S rDNA sites.
-
bioRxiv - Developmental Biology 2020Quote: ... with Biotin pre-labeled Uridine (Roche) and other reagents according to protocol for T7 RNA polymerase ...
-
bioRxiv - Developmental Biology 2019Quote: ... and digoxigenin (DIG)-labeled NTPs (Roche) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... and Digoxygenin (DIG) labeled dNTP’s (Roche), the resultant RNA cyp19a1 probe was then used for ISH.
-
bioRxiv - Molecular Biology 2024Quote: ... nuclei were labeled with DAPI (Roche). Immunofluorescence images were acquired using the Zeiss LSM700 confocal microscope with ZEN 2010 software.
-
bioRxiv - Neuroscience 2023Quote: ... antisense digoxigenin (DIG)-labeled riboprobes (Roche) were transcribed with SP6 or T7 RNA polymerase (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and digoxigenin (DIG)-labeled nucleotides (Roche). In situ hybridization was performed on wildtype and post-electroporation HH11-15 chicken embryos ...
-
bioRxiv - Developmental Biology 2024Quote: ... and digoxigenin (DIG)-labeled rNTPs (Roche) according to the manufacturer’s protocol and purified using RNA Clean and Concentrator kit (Zymo Research) ...
-
bioRxiv - Developmental Biology 2019Quote: ... for 1 hr and incubated overnight with sheep anti-DIG-POD primary antibody (1:1000, for the DIG-labeled probe; Roche) or mouse anti-biotin (1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... The antibodies used for the brain-ring gland complex included a rat anti-HA high-affinity monoclonal antibody (3F10, 1:20 dilution; Roche), a guinea pig anti-Shroud antibody (67 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in PBS for 30 min and incubated overnight at 4°C with 1:1,500 anti-HA high affinity (Roche, 3F10). After three PBS washes ...
-
bioRxiv - Cell Biology 2023Quote: ... The polyclonal antibodies anti-GFP (Roche), anti-Arp2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 ng of labeled probe was mixed with 10 μg of human Cot-1 DNA (Roche) and 10 μg each of salmon sperm DNA and E ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled probes were detected using mouse monoclonal anti-DIG primary antibody (Roche; 1:100 dilution) and a Cy3-labeled goat anti-mouse IgG secondary antibody (Roche ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of fosmid DNA was labeled by nick translation to incorporate biotin-dUTP (Roche 11093070910) or digoxigenin-dUTP (Roche 11093088910 ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of plasmid DNA was labeled by nick translation to incorporate biotin-dUTP (Roche 11093070910), digoxigenin-dUTP (Roche 11093088910 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... For western blot an anti-HA high affinity (Roche, cat: 11867423001) and a rat HRP were used ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies utilized include anti-HA-Peroxidase High Affinity (3F10, Roche, #12013819001), anti-FLAG M2 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... rat monoclonal anti-HA-Peroxidase high affinity (Roche, Sigma-Aldrich, 12013819001), rabbit polyclonal anti-Actin (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... or rat monoclonal antibody to hemagglutinin (HA) affinity matrix (3F10; Roche). Immunoblot analysis was performed with antibodies listed in Supplementary Table S1.
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies used for immunostaining included anti-HA (1:500, ROHAHA rat polyclonal, clone 3F10, Roche) and anti-GFP (1:2000 ...
-
bioRxiv - Plant Biology 2020Quote: ... transferred to a PVDF membrane and immunoblotted with rat monoclonal anti-HA (High Affinity, clone 3F10, Roche, www.roche.com; 1:2000 dilution) and hybridized with peroxidase conjugated goat anti-rat (Polyclonal ...
-
bioRxiv - Neuroscience 2020Quote: The following conjugated antibodies were used: sheep polyclonal anti-digoxigenin alkaline phosphatase (1:2000 - 1:5000; Roche Life Science, Cat#11093274910), mouse monoclonal anti-βACTIN (clone AC-15 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mRNA probes labeled with digoxigenin-UTP (Roche) were synthesized from 1 μg of the above PCR product using the ampliCapTM SP6 high-yield message marker kit (Cell Script).
-
bioRxiv - Molecular Biology 2020Quote: ... Digoxygenin (DIG)-labeled DNA probes (Roche, Germany) were generated by PCR according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and screened it using DIG-labeled (Roche) PCR probes to the center of the FLC locus (primers 5’ AGTGTAACTTCAATGGCAGAAAACCCT 3’ and 5’ ATGTGGCGGTAAGCAGAGATGACC 3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... and digoxygenin- or fluorescein-labeled nucleotides (Roche), and hydrolyzed to around 500 bp if needed ...
-
bioRxiv - Genomics 2019Quote: ... Digoxigenin (DIG) labeled nucleotides (Roche, Basel, Switzerland) were used to create amplified sequences with DIG labeled base pairs ...
-
bioRxiv - Developmental Biology 2024Quote: ... and digoxigenin (DIG)-labeled NTPs (11277073910, Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin or fluorescein labeled nucleotides (Roche). In situ hybridization was carried out using standard protocols (74) ...
-
bioRxiv - Physiology 2022Quote: ... Detection of DIG-labeled probes was performed by incubating with anti-DIG antibody (1:2000, Roche #11093274910) in 0.1% PBST overnight at 4° C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Bar amplified fragment (Table 1) labeled by DIG high primer DNA labeling (Roche, Cat. No. 11585614910) and purified using a high pure PCR product purification kit (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... Digoxigenin (DIG)-labeled or fluorescein (FITC)-labeled riboprobes were synthesized with T7 or T3 or SP6 RNA polymerase (Roche) from the linearized plasmids with DIG or FITC RNA labeling mix (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... Antibody concentrations used were: rat anti-HA high affinity (Roche, Basel, Switzerland) (1:1000) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50µl of bead slurry (HA High Affinity Matrix,11815016001, clone 3F10, Roche) was used per IP sample and was washed thrice by centrifuging for 2min at 500Xg ...
-
bioRxiv - Microbiology 2020Quote: ... m139-HA was immunoprecipitated with anti-HA Affinity Matrix (clone 3F10, Roche). DDX3 and UBR5 were precipitated with specific antibodies and PGS beads ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged ecMSG was loaded onto a gravity nickel affinity column (Roche) and eluted using 300 mM imidazole ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by affinity isolation with Protein A agarose beads (Roche, PROTAA-RO) overnight at 4°C on an end-over-end rotator ...
-
bioRxiv - Neuroscience 2021Quote: ... we labeled cell nuclei with DAPI (4’,6-diamidino-2-phenylindole; 1:10.000, Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Neuroscience 2020Quote: ... DIG-labeled Arc RNA probes were synthesized with a mixture of digoxigenin-labeled UTP (DIG RNA Labeling Mix, Roche Diagnostics) and purified using Probe quant G-50 Micro columns (GE Healthcare) ...
-
bioRxiv - Neuroscience 2021Quote: Digoxigenin RNA-labeled or Fluorescein RNA-labeled probes were transcribed in vitro using the RNA Labeling Kit (Roche Diagnostics Corporation) according to manufacturer’s instructions ...