Labshake search
Citations for Roche :
101 - 130 of 130 citations for Rubella Virus Nucleoprotein strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) and de-glycosylated for 3 h at 37 °C with 1 unit of PNGase-F (Roche Applied Science) added per 10 μl volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel pieces briefly rinsed with 50 mM AmBic and rehydrated in a small volume (10 μL) of 50 mM AmBic supplemented with 1 U PNGase F (Roche) at 37 °C for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... The quantity of WSSV genome copies was measured by absolute q-PCR using the primers of WSSV-F/R and a TaqMan fluorogenic probe named TaqMan probe-WSSV via LightCycler TaqMan Master kit (Roche) as described previously (Supplementary Table S2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... glands were minced into paste and incubated in 5 mL DME/F-12 medium (HyClone, #SH30023.1) with 2 mg/mL collagenase A (Roche #10103578001), 100 units/mL hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... The construct was synthesized by GenScript® and the plasmid was used as template for PCR amplification (Kapa Hifi Hotstart Ready Mix, Cat#F-530-L, Roche). The PCR amplicon was purified with NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2023Quote: ... the pocks positive for both BleCherry and GFP signals (pocks containing the recombinant green/red virus) were isolated for DNA extraction using High Pure Viral Nucleic Acid Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: Strain-specific barcodes were extracted by PCR using the amplified whole transcriptome as template (1x KAPA HiFi Hotstart Readymix, Kapa Biosystems #KK2602 ...
-
bioRxiv - Cell Biology 2019Quote: ... 125 mM NaCl, 1% NP-40, 2 mM EDTA, 1 mM PMSF [Sigma, 93482-50ML-F], and protease inhibitor cocktail [Roche, 000000011836170001) and incubated on ice for 25 min ...
-
bioRxiv - Genomics 2019Quote: We amplified 5 ng of the HSS library with the following primers: STARR-Seq-AG-f and STARR-Seq-AG-r (Supplemental Table 8) using KAPA HiFi 2x Readymix (Kapa Biosystems) with a 65 °C annealing temperature and 30 s extension ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR was performed in duplicate for each sample using the LightCycler 480 Real-Time PCR System (F. Hoffmann-La Roche, Ltd.) with the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... the strain of interest was inoculated from an exponential phase culture into 15ml of 7H9-OADC supplemented with kanamycin (Roche, 20ug/ml) and ATc (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... a total of 100 ng DNA from each bacterial strain was used according to KAPA Hyper Prep kit (KAPA Biosystems, MA, USA) at the Georgia Genomics and Bioinformatics Core (GGBC) ...
-
bioRxiv - Neuroscience 2019Quote: ... and Qiazol Lysis (Reagent cat.no.79306, Hilden, Germany) purified on MagnaPure LC (HP Kit no.03542394001, F. Hoffmann - La Roche AG, Rotkreuz, Switzerland) and amplified via real-time PCR (4ng RNA/reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... so that both DNA ends are blocked with 200 nM anti-digoxigenin Fab fragments (Roche Diagnostics, F. Hoffmann-La Roche Ltd, Switzerland) MutS heterodimers (50 nM monomer ...
-
bioRxiv - Immunology 2021Quote: ... and high density LP (HDL) fractions were determined by enzymatic colorimetric kits (Labtest do Brasil) in a Cobas automatic analyzer (F Hoffman-La Roche, Basel, Switzerland).
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer F (20 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 2 mM EGTA and Roche cOmplete protease inhibitor) and lysed by fluidizer ...
-
bioRxiv - Microbiology 2022Quote: ... The agtA gene disruption cassette was generated by fusion PCR using an Expand High Fidelity PCR System (F. Hoffmann-La Roche, Basel, Switzerland). The 5′- and 3′-arms of agtA were amplified from wild-type A ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library preparation was carried out using KAPA Hyper Prep and HiFi HS Library Amplification kits (F. Hoffmann-La Roche AG, Basel, Switzerland) and with iTru i5 and i7 dual-indexing primers (BadDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the product was used for the second round PCR using the primers F and R-T7 for generating antisense probe and primers R and F-T7 for generating sense probe used in ISH assays with the DIG RNA Labeling Kit (Roche, Mannheim, Germany),the primers were shown in table 1 ...
-
bioRxiv - Immunology 2023Quote: ... Library yields were assessed by qPCR using the KAPA Library Quantification Kit (Complete kit, Universal) (F. Hoffmann-La Roche AG, Basel, Switzerland) on the CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories Inc ...
-
bioRxiv - Cancer Biology 2019Quote: Four RNA-seq libraries (from CER217, CER218, CER220, and CER221 strains) were prepared with the KAPA Stranded mRNA-Seq Illumina® Platforms Kit (Roche-Kapa Biosystems) following the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2020Quote: ... were analyzed in serum samples by electrochemiluminescence immunoassays “ECLIA” (12149133 122 for Osteocalcin, 03141071 190 for PINP, 11972308 122 for CTX-I, all from F. Hoffmann-La Roche, Ltd., Basel, Switzerland)
-
bioRxiv - Microbiology 2022Quote: ... Approximately 800 μg of VLP lysate was then reduced and alkylated as described above and treated with 5 U PNGase F (Roche Cat. Nr. 11365177001) at 37 °C for 12 hours followed by 12 hours with 11 μg of trypsin ...
-
bioRxiv - Microbiology 2022Quote: ... All reactions were performed in duplicate using a real-time PCR system (LightCycler 96 System; F. Hoff Mann-La Roche Ltd., Basel, Switzerland). PCR amplification was performed as previously described (16) ...
-
bioRxiv - Immunology 2023Quote: ... and adapter-ligated using the KAPA PCR-free Hyper Prep Kit in combination with KAPA Unique Dual-Indexed Adapters (F. Hoffmann-La Roche AG, Basel, Switzerland). Adapter-ligated libraries were purified by AMPure XP bead cleanup ...
-
bioRxiv - Immunology 2023Quote: RNA-seq libraries and libraries containing both ATAC-seq and TaPE-seq were quantified by qPCR using the KAPA Library Quantification Kit (Complete kit, Universal) (F. Hoffmann-La Roche AG, Basel, Switzerland) on the CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories Inc ...
-
bioRxiv - Physiology 2023Quote: Blood glucose measurements were collected with a glucometer (ACCU−CHEK Performa, USA) and the proper test strips (F. Hoffmann-La Roche AG, Basel, Switzerland). Blood lactate was also measured with the Lactate Pro 2 handheld device and respective test strips (AKRAY Europe B.V. ...