Labshake search
Citations for Roche :
101 - 150 of 415 citations for Recombinant Human Histidine rich Glycoprotein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Insert amplification was performed using the Kappa Hi Fi Hotstart ReadyMix (Roche). For a 25 μL reaction ...
-
bioRxiv - Genomics 2022Quote: ... DNA libraries were amplified with KAPA 2× Hi-Fi Hotstart Readymix (Roche) and purified with 18% Sera-Mag Magnetic Beads in polyethylene glycol.
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was filtered and incubated with His-tag purification resin (Roche) overnight at 4°C while mixing gently ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... Hi-C libraries were prepared using KAPA LTP Library Preparation Kit (Roche) 65 with 12 amplification cycles ...
-
bioRxiv - Biochemistry 2023Quote: ... and applied to a 5 mL cOmplete His-tag purification column (Roche). The column was then washed with ∼100 mL of lysis buffer and bound proteins were eluted in 25 mL of lysis buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Cell Biology 2023Quote: ... Clarified lysate was loaded onto a cOmplete His-tag purification column (Roche), immobilized proteins washed with lysis buffer ...
-
bioRxiv - Microbiology 2019Quote: ... GRA16HA (and other HA-tagged proteins) was detected using rat anti-HA antibodies (Roche) while GRA24MYC was detected using rabbit anti-MYC tag antibody 9E10 (Santa Cruz Biotechnology) ...
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected with a mouse anti-GFP antibody (1:5000; Roche). Immunoblot results were quantified using Image J software (v1.8.0).
-
bioRxiv - Biochemistry 2020Quote: ... GFP-tagged proteins were detected with a primary mouse antibody IgG1K Anti-GFP (Roche) diluted to 1:1000 in 5 % (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation (IP) of HA-tagged proteins was performed using Anti-HA Affinity matrix (Roche) under denaturing conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... Immunoprecipitation of GFP/YFP-tagged proteins was performed with anti-GFP antibodies (11814460001, Roche) using a method we previously described (Ishii and Akiyoshi ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and DNA libraries were amplified with KAPA 2X Hi-Fi Hotstart Readymix (Roche).
-
bioRxiv - Biophysics 2019Quote: ... the crude extracts mixed with cOmplete His-Tag purification resin (Roche, Basel, Switzerland) were loaded onto a polyprep chromatography column (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full length cDNA amplification with Hi-Fi Hotstart Readymix (Roche, cat. no. 07959079001) was completed with a 98°C incubation then 21 cycles of (98°C for 15 sec ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 µL of the Ni-NTA slurry (Roche cOmplete His-Tag purification resin) was washed with 2x1 mL of wash buffer (WB ...
-
bioRxiv - Molecular Biology 2023Quote: ... After gap repair with Kapa Hi-Fi HotStart Uracil+ DNA Polymerase (KAPA Biosystems) and Taq DNA Ligase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the supernatant was loaded into cOmplete™ His-Tag Purification Resin (Roche) pre-equilibrated with wash buffer ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... or zebrafish genomic DNA using the Expand Hi-Fidelity PCR System (11732641001, Roche). Exact coordinates are listed in Supplemental Table 3 ...
-
bioRxiv - Genomics 2024Quote: ... The cleared lysate was loaded onto a cOmplete His-tag purification column (Roche) and the His6-Sumo3-Tn5 was eluted with a running buffer containing 300 mM imidazole ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants after high-speed centrifugation were loaded onto His-Tag Purific Resin (Roche), washed and eluted with 50 mM Tris.HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... HA-tagged proteins were detected and visualized using an HA antibody conjugated to HRP (Roche). For anti-HA immunoprecipitations ...
-
bioRxiv - Plant Biology 2021Quote: ... HA and GFP-tagged fusion proteins were detected using a Peroxidase-conjugated α-HA (Roche) or α-GFP (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged proteins were detected using mouse anti-GFP antibody (Roche 1814460, 1:1000 dilution) and anti-mouse-HRP antibody (Amersham ...
-
bioRxiv - Plant Biology 2022Quote: ... HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche) and anti-FLAG M2 (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Molecular Biology 2019Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) and incubated for 1 h at room temperature or 2 h at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) or Ni Sepharose High Performance (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... Fab was purified from cell culture supernatant by cOmplete His-Tag Purification Resin (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... His6-GFP and His6-mCherry proteins were purified with cOmplete His tag resin (Roche) according to the manufacturers protocols as previously described9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was added to cOmplete His-Tag Purification Resin (Merck Millipore/Roche) and incubated at 4°C for 1.5 h ...
-
bioRxiv - Genomics 2024Quote: ... the dialyzed sample was loaded again onto a cOmplete His-tag purification column (Roche), and the untagged Tn5 was collected in the flow-through ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.