Labshake search
Citations for Roche :
101 - 150 of 3663 citations for RNA Binding Motif Protein 45 RBM45 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Collected tissue was mechanically dissociated by chopping followed by enzymatic digestion for 45 minutes at 37°C in DMEM containing collagenase D (1.5 mg/ml, Roche) and DNase I (60 U/ml ...
-
bioRxiv - Immunology 2021Quote: ... then incubated for 45 min with constant shaking with “digest buffer” (RPMI; 10% FBS; 1mg/ml collagenase/dispase (Roche); 20μg/ml DNAse 1 (Sigma)) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... After the reaction between DIG-labeled RNA and anti-DIG antibody conjugated horseradish peroxidase (HRP) (Roche), sections were washed 3 times by TNT buffer (100 mM Tris-HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Each RNA probe was visualized by exposure to an anti-digoxigenin-alkaline phosphatase conjugate antibody (Roche) prior to exposure to a color reaction solution containing NBT/BCIP (nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyphosphate ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal antibodies were used to detect green fluorescent protein (GFP) (Cat#11814460001, clones 7.1 and 13.1, Roche). Rabbit polyclonal anti-Cdc42p antibodies were provided by Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Molecular Biology 2021Quote: ... exponentially growing cells were treated with DMSO or 1 μM PARPi for 24 h followed by 45 min incubation at 37°C with Colcemid (Roche). Metaphase preparation and aberration analysis were performed as it follows ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cell lysate was separated on 15%–45% linear sucrose gradient in presence of 0.1mg/ml Cycloheximide (CHX) and Phosphatase inhibitor (Roche# 4906837001) by centrifugation at 39,000 rpm in SW41 rotor for 90 min ...
-
bioRxiv - Bioengineering 2020Quote: ... Tissues were finely diced manually with standard razor blades and digested for 45 min at 37°C with 1.67 Wünsch U/mL (0.5 mg/mL) Liberase TL (Roche Diagnostics, Sigma Aldrich) and 0.2 mg/mL DNase I (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were incubated with 50 μl mix of 5 μl enzyme and 45 μl labeling solution (TUNEL In situ Cell Death Detection Kit, TMR Red’ from Roche) for 1.5 h at 37°C in a dark humid chamber ...
-
bioRxiv - Microbiology 2022Quote: PPs were excised from the SI and digested (37 °C, 45 min) using 100 µg/ml liberase TH/DNase (Roche) in RPMI containing 5 % FCS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subsequently the pellet was resuspended in 45 µl 10 mM sodium phosphate buffer supplemented with EDTA-free Protease Inhibitor Cocktail (Roche) and incubated (5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... tumors were mechanically minced and incubated for 30-45 minutes in DMEM/Ham’s F12 medium (Fujifilm, 042-30555) containing Liberase DH (Roche, 5401089001) at a final concentration of 0.26 U/mL at 37°C with continuous stirring ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 95 °C for 2 min and then 45 cycles of 95 °C for 15 s and 60 °C for 30 s using a Light Cycler 480 (Roche).
-
bioRxiv - Neuroscience 2022Quote: ... Samples were diluted 1:3 in ddH2O on ice in a 45 μL total volume before analysis in the Cobas c111 Analyzer (Roche). The Cobas c111 Analyzer is a platform for clinical chemistry testing of human samples but it can also be used to analyze mouse samples ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 95 °C for 2 min and then 45 cycles of 95 °C for 15 s and 60 °C for 30 s using a Light Cycler 480 (Roche).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC), and liver (human hepatocellular carcinoma, HepG2) [45–50] cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase activity was detected in the dark in AP buffer supplemented with 45 mg/ml 4-nitrobluetetrazolium chloride (NBT, Roche) and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Immunology 2023Quote: ... were isolated from spleens of naïve WT C57BL/6 mice by cutting samples into small pieces and incubating at 37°C for 45 minutes with 1U/ml DNase I (Roche) and 10U/ml collagenase D (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: Footpads and tips of mouse digits were dissected under a stereoscope microscope and digested for 45 min in 1g liberase TL (Roche)/1mL HBSS with calcium at 37C ...
-
bioRxiv - Developmental Biology 2021Quote: ... F0425)/500 µg protein with protein A-agarose (Roche). Fished-out FGFR3 protein was eluted and then denatured at 95°C for 10 minutes in NuPAGE LDS sample buffer (Life Technologies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Microbiology 2019Quote: ... Immunoprecipitated proteins were immunoblotted for GFP- or HA-epitope tagged ubiquitin with antibodies for GFP (1:3,000, Roche #11814460001) or HA (1:4,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were boiled 5 min and 50 μg of proteins were separated by electrophoresis on 12.5% SDS-PAGE and subjected to immunoanalysis with either anti-GFP antibody (Roche), anti-Pgk1 antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Microbiology 2019Quote: ... Whole cell extracts were prepared after transfection and incubated with indicated antibodies together with Protein A/G beads (Roche) overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... and the interaction between AtRsmD and the selected proteins was determined by immunoblot analysis with a mouse anti-GFP monoclonal antibody (1:5,000; Roche) and a mouse anti-Myc monoclonal antibody (1:10,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... Lysate was precleared with Pierce™ Protein G Agarose and immunoprecipitated with anti-GFP antibodies (Roche Cat. No. 11814460001) bound on protein G agarose ...
-
bioRxiv - Molecular Biology 2023Quote: ... isolated cell wall proteins were probed with anti-HA peroxidase-conjugated antibody (1:1,250 dilution; 11667475001, Roche, Basel, Switzerland).
-
bioRxiv - Systems Biology 2019Quote: ... The cross-linked proteins-RNA were cut directly from the gel and incubated with 160 μg of Proteinase K (Roche, 3115801001) in 600 μl wash buffer 2 supplemented with 1% SDS and 5 mM EDTA at 55°C for 2-3 hours with mixing ...
-
bioRxiv - Molecular Biology 2020Quote: ... were diluted 10 times in binding buffer (20mM Tris pH 8.0, 100mM NaCl, 5mM MgCl2, 0.4% NP40) and supplemented with protease inhibitors (Roche), 60µg of yeast tRNA (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... Real time PCR was performed with SYBR green as the DNA binding dye (Roche Applied Science, Mannheim, Germany) on a 7900HT Fast Real-Time PCR System (Applied Biosystems under Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... microtubules were treated with 200 μg/mL subtilisin for 45 min at 303 K as described previously.28 Proteolysis was stopped with the addition of 5 mM PMSF (Roche Diagnostics). Subtilisin-treated microtubules were spun at 100,000xg for 30 min at 298 K and were resuspended in reaction buffer at 5 mM MgCl2 ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). Human cells from differentiation experiments were also lysed in 300 µl Tri-Reagent for 5 minutes at RT mechanically dissociated/lysed using a sterile scraper ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Molecular Biology 2021Quote: ... treated with 5.8 μl of proteinase K (24 mg/mL, P4850) for 45 min at 55°C followed by 50 μg/ml RNase A (Roche, 10109169001) for 1 h at 37°C plus 1 h at 65°C ...
-
bioRxiv - Physiology 2023Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 min at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Cancer Biology 2024Quote: ... AATGATACGGCGACCACCGA-GATCTACACTCTTTCCCTACACGACGCTC and one of the SPLiT-seq sublibrary i7 index oligos BC0076-BC0083 combining 45 µL ADT cDNA with 50 µL 2x KAPA HiFi HotStart ReadyMix (Roche #KK2601) and 2.5 µL of 10 µM each PCR primer and ran the ADT-lib PCR cycle outlined in Table 5 ...
-
bioRxiv - Cell Biology 2020Quote: ... post-nuclear lysates pre-cleared using CL-4B Sepharose beads followed by immunoprecipitation with anti-HA-antibody (12CA5) and Protein G agarose (Roche). Beadbound radiolabelled substrates were resuspended in 2 x Laemmli buffer (+20 mM DTT) ...
-
bioRxiv - Cell Biology 2022Quote: ... The lysate was clarified for 30min at 15,000xg and the supernatant was immunoprecipitated for 2h at 4°C with Dynabeads-protein G covalently coupled to the rat anti-HA antibody (Roche). The beads were washed 3×5 min ...
-
bioRxiv - Biochemistry 2019Quote: ... 50 µl of the supernatant was kept as input and the remaining supernatant was used for immunoprecipitation with the indicated antibody coupled to protein A-Agarose (Roche) or in case of FLAG with anti-FLAG M2 Affinity gel (Sigma Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysed cells were centrifuged for 15 minutes at 13000 rpm and then the supernatants were incubated mouse monoclonal anti-huntingtin antibody MAB2166 (MilliporeSigma) conjugated Protein G Agarose (Roche) at 4°C for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: Surface expression of HA-C99 and cc-del(X) fusion proteins was measured with monoclonal HA-antibody (Roche 1:100) by flow cytometry as described previously (Staerk et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked in TBST with 5% milk protein and probed with the following antibodies: 1:1000 anti-HA (Roche), then 1:1500 goat anti-rat IgG-HRP (Dako) ...
-
bioRxiv - Molecular Biology 2024Quote: ... GFP-tagged Myh was isolated from cell lysate using Dynabeads Protein G (Thermo 10004D) and GFP-tag Antibody (Roche #11814460001). IP and input were boiled in 5xLaemmli Buffer and separated on an SDS-PAGE (8-16% ...
-
bioRxiv - Biochemistry 2024Quote: ... the proteins were transferred to a PVDF membrane and immunodetected with an anti-Myc-HRP antibody (Myc-HRP, 1:5000, Roche). The remaining 10% of the immunoprecipitated samples together with 50 μg of the input were subjected to the same procedure but probed with an anti-GFP antibody (JL-8 ...
-
bioRxiv - Developmental Biology 2021Quote: ... tissues were dissected in ice cold 1x PBS and transferred to low binding PCR tubes containing 50-100µL of 1x Protease Inhibitor Cocktail in 1xPBS (cOmplete mini EDTA-free; Roche) on ice ...
-
bioRxiv - Genomics 2020Quote: ... and mixed with 100 μL Binding Buffer (1% Triton X-100, 0.1% Sodium Deoxycholate, 1x complete protease inhibitor (Roche)) plus 100 μL 0.2 μg/μl chromatin followed by overnight incubation on a rotating platform at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were lysed (Avestin Emulsiflex C5) in lysis/binding buffer (20mM phosphate [pH7.4], 500mM NaCl, 20mM imidazole, protease inhibitor cocktail [Roche]), clarified lysate was applied to a 5mL HisTrapHP column (GE Healthcare ...