Labshake search
Citations for Roche :
101 - 150 of 6330 citations for Oxytocin ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... with glucose concentrations determined in whole blood by a portable meter (Roche Diagnostics, UK). Glucose and insulin tolerance tests were performed by blood sampling after an intraperitoneal injection of glucose (1 mg/g ...
-
bioRxiv - Immunology 2019Quote: ... Whole transcriptome amplification was achieved by addition of KAPA HiFi HotStart ReadyMix (Kapa Biosystems) and IS PCR primer (ISPCR ...
-
bioRxiv - Systems Biology 2020Quote: ... Whole transcriptome amplification was achieved by addition of KAPA HiFi HotStart ReadyMix (Kapa Biosystems) and ISPCR primer to the reverse transcription product and amplification on a thermal cycler using the following protocol ...
-
bioRxiv - Molecular Biology 2020Quote: Whole tissue or cell lysates were produced in RIPA buffer supplemented with PhosSTOP (Roche Diagnostics Corporation ...
-
bioRxiv - Immunology 2022Quote: ... and whole transcriptome amplification (WTA) using the KAPA HiFi HotStart ReadyMix 2X (KAPA Biosystems) for 12 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... Whole transcriptome amplification (WTA) was performed with KAPA HiFi PCR Mastermix (Kapa Biosystems KK2602) using approximately 6,000 beads per 50 μL reaction volume ...
-
bioRxiv - Cancer Biology 2022Quote: ... whole glands were incubated in blocking buffer containing 1% bovine serum albumin (Roche Diagnostics), 5% normal goat serum (Monosan ...
-
bioRxiv - Immunology 2023Quote: ... Whole transcriptome amplification (WTA) was performed with KAPA HiFi PCR Mastermix (Kapa Biosystems KK2602) using approximately 6,000 beads per 50 μL reaction volume ...
-
bioRxiv - Immunology 2024Quote: ... Whole transcriptome amplification was carried out using KAPA HiFi PCR Mastermix (Kapa Biosystems KK2602) with 2000 beads per 50-μl reaction volume ...
-
bioRxiv - Cancer Biology 2019Quote: ... For each solution 5×10 µL aliquots were transferred to a 384 well plate and placed in a Lightcycler 480 (Roche Life Science). The temperature was increased from 25 °C to 95 °C using a gradient of 0.06 °C/second ...
-
bioRxiv - Synthetic Biology 2022Quote: ... clear plates (Roche).
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Genetics 2020Quote: ... A LYS2 probe was amplified and labeled with Digoxigenin (DIG)-dUTP using the primers 5’-TGAAGCCTTCCCAGAGAGAA and 5’-GCCAAGGAAAAATGTCTACCA (Roche PCR DIG Probe Synthesis Kit). The DIG probe was hybridized to the membrane (at 44°C ...
-
Heat Shock Factor 1 (HSF1) as a new tethering factor for ESR1 supporting its action in breast cancerbioRxiv - Cancer Biology 2021Quote: Whole-cell extracts were prepared using RIPA buffer supplemented with CompleteTM protease inhibitors cocktail (Roche) and phosphatase inhibitors PhosStopTM (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: Whole cell lysates were prepared in RIPA buffer with protease and phosphatase inhibitor cocktails (Roche). Lysates were subjected to SDS PAGE electrophoresis and transferred onto PDVF membrane (Millipore) ...
-
bioRxiv - Systems Biology 2021Quote: Whole-cell lysates were obtained using RIPA buffer supplemented with protease and phosphatase inhibitors (Roche). An amount of 10 µg of protein was then resolved on 10-12.5% polyacrylamide gels and transferred to nitrocellulose membranes using the semi-dry technique ...
-
bioRxiv - Immunology 2020Quote: Whole cell extracts were prepared in the presence of protease inhibitor cocktail (Roche, Mannheim, Germany), phosSTOP phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and second strand synthesis en masse followed by whole transcriptome amplification (WTA, Kapa Biosystems KK2602) in 1,500 bead reactions (50 μL) ...
-
bioRxiv - Microbiology 2022Quote: Whole-cell lysates were prepared using Triton-X sample buffer containing protease inhibitor cocktail (Roche). The protein concentration was assessed by using DC Protein assay reagent (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2022Quote: Whole-cell lysates were prepared using Triton-X sample buffer containing protease inhibitor cocktail (Roche). The protein concentration was assessed by using DC Protein assay reagent (Bio-Rad Laboratories) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and for whole mount in situ hybridization (WISH) we used anti-digoxigenin-AP antibody (Roche cat ...
-
bioRxiv - Neuroscience 2023Quote: ... whole-flies or adult heads were homogenized in RIPA lysis buffer with protease inhibitor (Roche) using a mortar and pestle ...
-
bioRxiv - Immunology 2023Quote: ... Whole transcriptome amplification (WTA) was achieved via PCR using KAPA Hifi PCR Mastermix (Kapa Biosystems). The WTA product was purified using Agencourt Ampure beads (Beckman Coulter) ...
-
bioRxiv - Immunology 2020Quote: ... at 37° C 5% CO2 in 96 well plates in the presence of IL2 (GIBCO 100 IU/mL or Roche 1 ng/mL). Additional conditions included 1 ng/mL TGFβ (GIBCO) ...
-
bioRxiv - Genomics 2021Quote: ... Final libraries were PCR-amplified during 5 cycles with Kapa HIFI PCR kit (Roche, Basel, Switzerland) before standard library quality control with standard sensitivity NGS Fragment kit (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA was extracted from 5-8 pairs of ovaries using an RNA extraction kit (Roche). 50 ng of total RNA was used to make cDNA using the Transcriptor First Strand cDNA Synthesis kit (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: The BrdU assay was performed using the Cell Proliferation ELISA BrdU assay (Roche #11647229001) according to manufacturer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cellular proliferation was assessed with the BrdU cell proliferation ELISA (11647229001, Roche, Basel, Switzerland). In brief ...
-
bioRxiv - Genetics 2019Quote: Whole testes were snap-frozen in liquid nitrogen before extraction buffer with protease inhibitors (Roche 1836153) and bensonase (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... Whole transcriptome amplification was performed using the 2X KAPA Hifi Hotstart Readymix (KAPA Biosystems, KK-2602). Beads were split to 1,500-2,000 per reaction and run under the following conditions 4 Cycles (98℃ ...
-
bioRxiv - Developmental Biology 2022Quote: ... Whole-mount two-color fluorescence ISH was performed using anti-DIG and -fluorescein POD antibodies (Roche) and Tyramide Signal Amplification (TSA ...
-
bioRxiv - Cancer Biology 2020Quote: Whole-cell protein lysates were harvested in lysis buffer (RIPA buffer supplemented with protease inhibitor (Roche), sodium vanadate and sodium molybdate ...
-
bioRxiv - Cell Biology 2020Quote: ... whole cell lysate of primary myoblasts was prepared by lysing buffer containing protease inhibitor cocktail (Roche). Protein concentration was determined with the BCA Protein Assay Reagent (Pierce Biotechnology ...
-
bioRxiv - Genomics 2021Quote: ... and whole transcriptome amplification (WTA) by PCR was performed using KAPA Hifi PCR Mastermix (Kapa Biosystems). WTA product was purified using Agencourt Ampure beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: Whole-cell protein lysates were harvested in lysis buffer (RIPA buffer supplemented with protease inhibitor (Roche), sodium vanadate and sodium molybdate ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids were purified from whole blood or serum using the MagNA Pure 96 system (Roche) with the DNA/Viral NA 2.0 kit and the Viral NA Plasma external lysis S.V ...
-
bioRxiv - Systems Biology 2023Quote: ... 60 µL whole-transcriptome amplification (WTA) master mix (50 µL 2x KAPA HiFi Hotstart Readymix [Roche #KK2602] ...
-
The Polycomb group protein MEDEA controls cell proliferation and embryonic patterning in ArabidopsisbioRxiv - Developmental Biology 2020Quote: ... on 384-well plates (LightCycler 480 white plates and sealing foils, ROCHE), using 0.7μl of DNA per replicate and the SsoAdvanced Universal SYBR Green Supermix (BIORAD) ...
-
bioRxiv - Cancer Biology 2023Quote: RNA extraction from A549 cells grown in 6-well plates was done using High Pure RNA isolation kit (Roche). Transcriptor First strand kit (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Whole cell extracts were prepared by lysis in RIPA buffer supplemented with protease and phosphatase inhibitors (Roche). Protein concentration was quantified by BCA assay (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... whole mount immunohistochemistry was carried out first using standard procedure that included RNase inhibitor (1:100, Roche) during the blocking steps and used a primary antibody for RFP ...
-
bioRxiv - Genomics 2022Quote: One µg of DNA was used for whole genome bisulfite sequencing library preparation (KAPA Biosystems, Wilmington, MA), bisulphite conversion (Epitect Fast DNA Bisulfite Kit (Qiagen)) ...
-
bioRxiv - Cell Biology 2020Quote: Whole cell or mitochondrial samples were lysed in RIPA buffer supplemented with cOmplete protein inhibitor cocktail (Roche) and 1mM phenylmethylsulfonyl fluorid (PMSF) ...
-
bioRxiv - Genomics 2022Quote: Whole cell extracts were prepared by resuspending cells in PBS with complete proteinase inhibitor (Roche, Cat#18970600), centrifugation ...
-
bioRxiv - Immunology 2023Quote: ... minced whole spleens were digested in basal RPMI 1640 supplemented with 25 ug/ml Liberase TM (Roche) and 25 ug/ml DNase I (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... whole transcriptome amplification by PCR was performed for 12 cycles using KAPA HiFi HotStart ReadyMix (Roche, 7958935001) with a PCR primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Biochemistry 2019Quote: ... Blocking reagent for ELISA (BRE) and cOmplete protease inhibitor tablets were from Roche (Basel, Switzerland). Phosphate buffered saline (PBS ...